1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Deffense [45]
3 years ago
9

Most gaseous pollutants come from a group of chemicals called _____.

Biology
2 answers:
DerKrebs [107]3 years ago
8 0
OXIDES is your answerrrrrrr !!!!!!!!
Lemur [1.5K]3 years ago
3 0

The correct answer is option A, that is, oxides.  

Air pollution refers to the kind of pollution that takes place because of the discharge of noxious gases, like carbon monoxide, sulfur dioxide, chemical vapors, and nitrogen oxides. These gases can get involved in further chemical reactions once they reach the atmosphere, forming acid rain and smog.  

Air pollution can exhibit various kinds of health associated influences, both long term, and short term.  


You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
What does exercise create in muscle fibers.... hormones, lactic acid, enzymes, red blood cells, tears?
dolphi86 [110]
Lactic acid

Yes this is right
6 0
3 years ago
Read 2 more answers
Which is a pollutant associated with high-tech gadgets in landfills?<br>​
ZanzabumX [31]

Answer:

Lead is the major pollutants of high-tech gadgets, occupying 40%, while other metals 75%.This is because Pb forms lager components of these gadgets.For example a desktop computer contains about 10 pounds of Pb.

The lead to recycle these material to prevent pollution is important.

Explanation:

6 0
4 years ago
Read 2 more answers
Give all the possible Anti-codons for the amino acids listed below. (Use page 244 in your text). Histidine (His)
Stells [14]

Answer:

idek

Explanation:

lol i’m failing

4 0
3 years ago
___________________________ structure is the distribution of individuals among various age groups in a population.?
chubhunter [2.5K]

Answer:

<u>Distribution</u> structure is the distribution of individuals among various age groups in a population.?

Explanation:

5 0
3 years ago
Other questions:
  • Using a food pyramid put these animals in it. snake plants owl warbler caterpillar preying mannis.
    9·1 answer
  • Are all characteristics of a volcano dangerous?
    15·1 answer
  • The sum of all chemical reactions in a cell is referred to as
    12·1 answer
  • FIRST ANSWER GETS BRAINLIEST
    12·2 answers
  • S: blog
    13·1 answer
  • Which BEST describes why the hatchet fish has been able to survive?
    6·1 answer
  • Which type of bond joins the COOH group of one molecule to the NH2 of another molecule? A. 1-4 Glycosidic bond B. Ester bond C.
    15·1 answer
  • Pls help! on gregor mendel
    12·1 answer
  • A pea plant with purple flowers and green pods is crossed with a plant that has white flowers and yellow pods.All the offspring
    13·1 answer
  • B. How does an Amoeba get its nutrition?<br>If answered correctly will be marked as brainliest.​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!