1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
12

Which gases contribute to the green house effect

Biology
1 answer:
vodomira [7]3 years ago
6 0
Carbon dioxide and methane.
You might be interested in
What process does a multicellular organism use to replace its damaged body cells?
Solnce55 [7]
Mitosis I think is the answer
7 0
3 years ago
Read 2 more answers
A bog is a type of wetland with witch of the following
liq [111]

Answer:

Still acidic water

Explanation:

A bog or bogland is a wetland that accumulates peat, a deposit of dead plant material—often mosses, and in a majority of cases, sphagnum moss. It is one of the four main types of wetlands. Other names for bogs include mire, mosses, quagmire, and muskeg; alkaline mires are called fens.

6 0
3 years ago
The method animals use to attract mates to reproduce
tia_tia [17]

Answer:

A lot of birds sing or dance to attract their mates or show off their beautiful colors. Fireflies flash their lights to attract females.

Explanation:

See answer above.

If you can please make my answer the brainliest that would be much appreciated. Thanks!

5 0
3 years ago
Proteins and carbohydrates have many functions in the body of an organism. Specific proteins and carbohydrates perform specific
Dennis_Churaev [7]

Answer:

A.Both store materials needed by the organism

hope it helps..

4 0
3 years ago
Computers are able to continue their operation even when problems are present.
Dima020 [189]

FAULT-TOLERANT computer systems are systems that are built with the ability to keep working to a level of satisfaction, even in the presence of faults within one or more of its components. <span>This fault tolerant ability is sometimes referred to as graceful degradation</span>

8 0
3 years ago
Other questions:
  • What do plant cells take in to make their own food
    15·1 answer
  • When might an increase in biodiversity lead to a decrease in the stability of an ecosystem?
    7·1 answer
  • Which function of the muscular system is best illustrated by the heart pumping blood throughout the body?
    13·2 answers
  • How does wind primarily cause erosion
    6·1 answer
  • What happens to food and energy when it enters the cell?
    5·1 answer
  • What are the basic building blocks for DNA and RNA?
    5·2 answers
  • How has technology changed the way people communicate?
    12·2 answers
  • Carbon dioxide is released by _____ and_____?
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What are ribs? Use in your own words.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!