Answer:
Parasitism describes a relationship between two organisms where one gets benefit and other get harm.
Explanation:
Parasitism is a type of symbiotic association that is present between two different organisms. In association, one organism gets benefit from the other and the other is damaged. For example, association between mosquitoes and human is parasitism because mosquitoes get benefit in the form of food while human is damaged due to disease cause by mosquito biting.
Microevolution - Allele frequency changes in a certain population over an amount of generations, it can also be simply described as "an evolutionary change in populations".
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The disorder where the grandfather and the grandchild are affected is related with the X chromosome and is called Sex linked or X linked disorder.
<h3><u>Explanation:</u></h3>
All the sex linked disorders are recessive in character i.e the normal allele is dominant over the mutated allele. In females, there are 2 X chromosomes, so the mutated allele is only expressed when there are both the mutated alleles, else its masked by the dominant normal allele. But in males, there's only one X chromosome, so if a mutated allele is present, it's readily expressed.
If the Grandfather is diseased, then he must have that mutated allele in X chromosome. Through reproduction, its received by the mother, but she is normal because the other allele received from grandmother was normal. But mother has one of the X chromosomes with mutated allele, which is received by the grandson who again becomes diseased.
So the disorder must be X linked disorder
