The only approach that does not consider internal factors is

Biology

1 answer:

kari74 [83]3 years ago

6 0

A behaviorism at least that's what I think

You might be interested in

For a project I needed to ask 25 people : do you think eating meat is bad for the environment?

Lelu [443]

Answer:

Yes (It's more inefficient)

Explanation:

in ecology there are things called primary producers (plants) that are eaten by primary consumers (cows and chickens) and then there are humans, secondary consumers, that eat cows and chickens for energy.

The further we move from eating primary producers the more inefficient we become in consuming energy. Meaning, it requires a lot more natural energy consumption to support a human that lives on meat only as compared to a human that eats plants only. this inefficiency only magnifies when communities practice unsustainable food methods.

There are sustainable ways to eat meat, but (at least in the US) our current conventions of meat production are unsustainable and environmentally destructive.

5 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein