The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
This is because a sample is supposed to ideally represent the whole population from which it was taken. Taking samples from different location within the population ensures that they are no bias in the sample. Each part of the population should be well represented in the sample so that the conclusions drawn from the sample represent the properties of the whole population.
Answer:
The correct answer is "The "host range" for a virus is determined by the presence or absence of particular components on the surface of a host cell that are required for the virus to attach".
Explanation:
The missing option of this question is the one that is correct, which is "The "host range" for a virus is determined by the presence or absence of particular components on the surface of a host cell that are required for the virus to attach". A virus is able to infect by recognizing particular components that are present in the surface of the host cell. If this components are absent in the cell, the virus is not able to infect it. Therefore, the "host range" is determined by the presence or absence of this particular components.
Answer:
butt hole fart head stink butt water dixk