1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
6

One way to understand how early environment influences behaviors in similar species is through the "cross-fostering" experimenta

l technique. Suppose that the curly-whiskered mud rat differs from the bald mud rat in several ways, including being much more aggressive. How would you set up a cross-fostering experiment to determine if environment plays a role in the curly-whiskered mud rat's aggression?
A) You would cross curly-whiskered mud rats and bald mud rats and hand-rear the offspring to see if any grew up to be aggressive.B) You would place newborn curly-whiskered mud rats with bald mud rat parents and place newborn bald mud rats with curly-whiskered mud rat parents. Finally, let some mud rats of both species be raised by their own species. Then you would compare the outcomes.C) You would remove the offspring of curly-whiskered mud rats and bald mud rats from their parents, raise them in the same environment but without parents, and then compare the outcomes.D) You would replace normal newborn mud rats with deformed newborn mud rats to see if it triggered an altruistic response.
Biology
1 answer:
Kisachek [45]3 years ago
3 0

Answer:

.B) You would place newborn curly-whiskered mud rats with bald mud rat parents and place newborn bald mud rats with curly-whiskered mud rat parents. Finally, let some mud rats of both species be raised by their own species. Then you would compare the outcomes.

You might be interested in
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
konstantin123 [22]
The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.

This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3'  </span><span>the direction (--->)
3' ..</span>aatcg........................ 5'   the direction (<---)

adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).



3 0
3 years ago
Which of the following is present in plant cell division but not in animal cell division?
GREYUIT [131]

Answer:

C

Explanation:

cytokinesis

6 0
3 years ago
Read 2 more answers
Suppose you conduct an investigation to find out the types of soil in your neighborhood why would it be helpful to test soil at
topjm [15]

This is because a sample is supposed to ideally represent the whole population from which it was taken. Taking samples from different location within the population ensures that they are no bias in the sample. Each part of the population should be well represented in the sample so that the conclusions drawn from the sample represent the properties of the whole population.

7 0
4 years ago
Which of the following statements concerning viruses is true? View Available Hint(s) Which of the following statements concernin
weqwewe [10]

Answer:

The correct answer is "The "host range" for a virus is determined by the presence or absence of particular components on the surface of a host cell that are required for the virus to attach".

Explanation:

The missing option of this question is the one that is correct, which is "The "host range" for a virus is determined by the presence or absence of particular components on the surface of a host cell that are required for the virus to attach". A virus is able to infect by recognizing particular components that are present in the surface of the host cell. If this components are absent in the cell, the virus is not able to infect it. Therefore, the "host range" is determined by the presence or absence of this particular components.

6 0
3 years ago
Use the table below to answer this questions ​
malfutka [58]

Answer:

butt hole fart head stink butt water dixk

5 0
3 years ago
Other questions:
  • What three sources of ATP does your body use during a long aerobic exercise session?
    10·1 answer
  • Dr. bronson treats anxiety disorders with xanax, which exemplifies ________ therapy.
    14·1 answer
  • Name four nitrogen bases
    13·2 answers
  • _____ are amphibians that most closely resembles early tetrapod in the body form. A. Frogs B. Snakes C. Salamanders D. Toads
    14·2 answers
  • Some substances are transported within the cell or across membranes with membranous sacs what are these structures called?
    5·1 answer
  • Energy that is taken from an organism and is not available to other organisms in the food web is placed where ?
    13·2 answers
  • Which of the following is true about temperate forests?
    8·1 answer
  • Hi I really need help!! :)
    6·2 answers
  • When your hungry the body releases a hormone hearing a noise causes the hormone for a threat which body system is responsible.
    7·1 answer
  • For an animal cell, the main advantage of aerobic cellular respiration over lactic acid fermentation is that
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!