1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
12

Saprophytes are fungi that feed on dead and decomposing organisms. They secrete enzymes that digest components of cell walls, su

ch as cellulose and lignin. Which statement explains why these fungi are an important part of the biogeochemical cycle?
A) Saprophytes perform gas exchange that assists the cellular activities of autotrophs.
B) Saprophytes extract minerals from living tissue to recycle them back into the soil.
C) Saprophytes transport nutrients through the xylem and phloem in autotrophs.
D) Saprophytes return organic material to the soil for use by living organisms
Biology
2 answers:
pickupchik [31]3 years ago
7 0

Answer:

The answer would be D

Explanation:

This is true because one of the main things for fungi to do is breaking down materials, when they break materials down it is easier for them to mix in with the ground around them there fore causing them to be returned.

almond37 [142]3 years ago
5 0

Answer:

D) Saprophytes return organic material to the soil for use by living organisms

Explanation:

Saprophytes are organisms that feed on organic matter originating from decomposition processes. They are heterotrophic because they obtain energy from organic matter in other living beings.

The main saprophytic living beings are terrestrial fungi and some species of vascular plants. They are essential for biogeochemical cycles, because they return organic material to the soil for use by living organisms.

In other words, we can say that saprophytes act as nutrient recyclers. They act in the process of decomposition of the substrate (place where they live), favoring the use of substances by other organisms. This process also favors soil fertilization.

Example: there are fungi that decompose rotting tree branches and stumps. The result of this process generates organic substances that serve as nutrients for other organisms in that ecosystem.

You might be interested in
Please please helppppp!!!!!!
inn [45]
C is the answer to the question
7 0
3 years ago
Read 2 more answers
Carbon dioxide and oxygen enter and exit a leaf by diffusion. which structure(s) on a leaf allow(s) this process to happen?
Montano1993 [528]
The stomata and their guard cells allows this happen.

Stomata is like a hole or gap on a leaf, most of them are present in a bottom side of the leaf, since waxy cuticle is not present over there. And 2 guard cells make up a stomata.

Guard cells are able to control the size of the stomata, depending on the situation. For example, the guard cells close up during day time because a lot of sunlight may cause more water loss.

In conclusion, guard cells and the stomata are the main structures that allow carbon dioxide and oxygen (water too) diffuse in and out of leaves.
3 0
3 years ago
Ticks suck blood from a host organism. This is an example of
kherson [118]
I'm pretty sure the answer is D
4 0
3 years ago
Which of the following plants bear flowers? acadia,moss,fern,liverwort​
Alex17521 [72]

Answer:

acadia bear flowers

8 0
3 years ago
What chromosomal disorder is illustrated in Figure 14–9?
kodGreya [7K]
Answer is: <span>nondisjunction.
</span>Nondisjunction<span> is the failure of </span>homologous chromosomes<span> to separate correctly during </span>cell division, because of tha daughter cells have abnormal chromosome numbers. This example is <span>failure of a pair of </span>homologous chromosomes<span> to separate in </span><span>meiosis I.</span>
4 0
3 years ago
Other questions:
  • A myofibril is a cylindrical bundle of contractile myofilaments within the skeletal muscle cell. True or False
    6·2 answers
  • What are some environmental factors (stimuli) that organisms respond to
    7·1 answer
  • Can a doctor be intimate with current patient
    14·1 answer
  • Suppose you are investigating an autosomal recessive disease known as "studius toxicosis" which occurs at a rate in the American
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If the sequence of one strand on DNA is CTA GCT CCA, what is the<br> complementary strand? *
    8·1 answer
  • I need help please?????
    11·2 answers
  • What is the economic important of butterfly and sugar ant​
    13·1 answer
  • Please help! thank you
    15·1 answer
  • What would happen to the liquid levels in the glass tube ​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!