1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir2022 [97]
3 years ago
13

A seed only germinates when environmental conditions are good. True or False

Biology
1 answer:
balu736 [363]3 years ago
8 0
True. If (environmental) conditions were bad, the seed would not be able to survive :)
You might be interested in
Which best describes the process of conduction?
Kisachek [45]
Because it is direct contact of the molecules in the air and the land that are touching.
5 0
3 years ago
Which is used to create copies of genetic material for DNA fingerprinting?
Nana76 [90]

Answer: A

Explanation: PCR help to create multiples of copies, it can produce millions of copies of DNA sequence in a test type in limited or few hours. PCR has revolutionize molecular biology, and it has become an essential tools for biologist, physicians or anyone who really want to work on the DNA.

8 0
3 years ago
Vhat is the function of the cell wall in a plant cell?
In-s [12.5K]

Answer:

The cell wall gives the plant stability

Explanation:

6 0
3 years ago
Read 2 more answers
How the structure of DNA determines the structure of proteins?
Kruka [31]

Answer:

DNA carries the genetic information for making proteins. ... The base sequence determines amino acid sequence in protein. Messenger RNA (mRNA) is a molecule which carries a copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.

Explanation:

(meow) <3

3 0
3 years ago
Polar molecules are<br> nonpolar molecules are<br> ---and
PIT_PIT [208]

Answer:

A polar molecule is a molecule that has a positive and negative charge at either end.

4 0
3 years ago
Other questions:
  • The two basic kinds of nucleic acids are
    9·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • True or False. Humans produce waste but other animals do not.
    8·2 answers
  • Which branch of biology examines the form and variety of organisms in their natural environment?
    6·1 answer
  • How bacteria sense the magnetic field of earth?
    13·1 answer
  • Genetic drift and gene flow have what in common?
    14·1 answer
  • The term ""insecure laboratory procedures"" in the definition of a bio-hazard presented in this educational module refers to whi
    12·1 answer
  • Point
    6·1 answer
  • Evidence for sea-floor spreading has come from which option?
    10·1 answer
  • How has natural selection shaped our earth today?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!