1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
2 years ago
5

The diagram shows a bean plant growing in soil.

Biology
1 answer:
Sphinxa [80]2 years ago
5 0

Answer:

A

Explanation:

You might be interested in
What is the resting phase of a cell
Alina [70]

Answer:

G 0 is a resting phase where the cell has left the cycle and has stopped dividing. The cell cycle starts with this phase.

7 0
3 years ago
Read 2 more answers
A certain mutation in the gene for hemoglobin results in the red blood cells becoming sticky,
lorasvet [3.4K]

Answer:J

Explanation:Substitution

5 0
3 years ago
What is the significance of a recombinant plasmid?
drek231 [11]

Answer:

recombinant DNA

A strand of DNA formed by splicing DNA from 2 different organisms is called recombinant DNA

Explanation:

Using the techniques of recombinant DNA technology, certain enzymes known as restriction enzymes capable of cleaving double stranded DNA in the plasmid of bacteria genomes (other organisms like eukaryotes can also be used) are used to obtain specific sequences of DNA bearing desirable traits in the both organisms.

Once the two DNA fragments have been obtained, another enzyme known as DNA ligase is used to seal the point of splicing, thereby constructing a single DNA from the two organisms.

This single DNA is known as Recombinant DNA

7 0
2 years ago
Sientific method hypothesis​
Assoli18 [71]
The process of the scientific method involves making conjectures (hypotheses), deriving predictions from them as logical consequences, and then carrying out experiments or empirical observations based on those predictions. A hypothesis is a conjecture, based on knowledge obtained while seeking answers to the question.
6 0
3 years ago
Which two are necessary for a functional ecosystem?
Art [367]

Answer:C and D

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • What is the difference between the null and alternative hypotheses? Give an example of each. How would you support or fail to su
    11·1 answer
  • After a major environmental change, what happens to species that do not adapt or move?
    9·2 answers
  • The earliest hominin that belong to the same genus as modern humans was probably?
    6·1 answer
  • Dopamine is a neurotransmitter involved in the reward pathways in the brain, and its decreased activity has been associated with
    6·2 answers
  • What are the four major categories of biomolecules?
    9·2 answers
  • If the pressure acting on a gas is reduced, what will happen to the volume at a constant temperature?
    8·1 answer
  • What do you think that some atroids tumble over end through space while other asteroids rotate around their axis
    6·1 answer
  • What type of genetic testing is most sensitive for detecting any mutation in a specific gene
    10·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Las característica de los bioelementos
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!