1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
6

In order for nuclear fusion to occur, the core of the sun must be hot enough to overcome the _________ of the nuclei. select one

:
a. electromagnetic repulsions
b. solar wind
c. gravitational tides
d. strong nuclear forces
e. doppler effect
Chemistry
1 answer:
andreyandreev [35.5K]3 years ago
7 0
The answer is option a, that is " <span>electromagnetic repulsions</span><span>".
The sun generates energy by nuclear fusion, and converts a part of its mass into energy and nuclear fusion is the source of all energy that is released by the sun. The two things which are required for the process of nuclear fusion are high temperature and the high densities.

</span>
You might be interested in
Please help help helpppppppp
Leviafan [203]
1. Magnesium atoms also have a slightly smaller radius than sodium atoms, and so the delocalised electrons are closer to the nuclei.
2. Sodium has higher melting point than potassium because of stronger metallic bonding .
3. Potassium are very soft metal can be very easily cut with a knife
4. Increase of resistance in metals. Therefore the mobility of electrons decreases and causes decrease in conductivity.
5.To increase strength, increase corrosion resistance, or reduce costs.
6. All metals have low ionization energies and are relatively electropositive, and so they lose electrons fairly easily.
7. All the group 1 metals are reactive, but they get more reactive as you go down the group, so potassium is more reactive than sodium.
5 0
2 years ago
How does chemistry affect our world?
Anit [1.1K]

Answer:

Research is constantly deepening our understanding of chemistry, and leading to new discoveries. Chemistry will help us solve many future problems, including sustainable energy and food production, managing our environment, providing safe drinking water and promoting human and environmental health.Chemistry is a big part of your everyday life. You find chemistry in daily life in foods you eat, air you breathe, soap, your emotions and literally every object you can see or touch. ... Food is made from chemicals. Many of the changes you observe in the world around you are caused by chemical reactions.By observing chemical reactions, we are able to understand and explain how the natural world works. Chemical reactions turn food into fuel for your body, make fireworks explode, cause food to change when it is cooked, make soap remove grime, and much more.

6 0
3 years ago
For each of the following compounds, write the symbols of the ions in the compound, and the number of each ion in the molecule o
Kay [80]
Ca^2+ and I^-
Na+ and Co3^2-
Ga^3+ and ClO3
Cu^2+ and F-
NH4^- and PO4^3-
Fe2+ and (SO4)^2-
Mg2+ and NO3^-
NH4^+ and NO2^-
K^+ and (C2H3O2)^- {C2H3O2 is acetate}
Na^+ and Cr2O7^2-
8 0
3 years ago
Which of the following best compares the structure of carbohydrates and nucleic acids?
Serga [27]
I believe the best description comparing the structure of carbohydrates and nucleic acids would be A.
5 0
3 years ago
Read 2 more answers
Which organelle is the control center of the cell?
Ivenika [448]

Answer:

nucleus

Explanation:

6 0
3 years ago
Other questions:
  • Hydrogen is 99% hydrogen-1; 0.8% hydrogen-2; and 0.2% hydrogen-3. calculate it's average atomic mass
    10·2 answers
  • The rule that an atom gains or loses electrons to form a full valance electron shell is often called the octet rule
    5·1 answer
  • How can hypotheses best be tested?
    14·2 answers
  • Why are lager astronomical bodies such as planets and stars round?
    12·2 answers
  • HELLLPP QUICK WILL MARK BRAINLIEST
    5·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • 3. What are the planets called that are mostly made of gas?
    13·2 answers
  • Jen and her partner were assigned the Zn/Zn cathode/anode pair which they used to construct their electrolytic cell. They decide
    6·1 answer
  • Which of the following represents the electron configuration of s⁻?
    8·1 answer
  • What is the number of atoms of oxygen in 0.1 mol of CuSO4.5H2O? &amp; explain​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!