The domain of the new species of unicellular microorganism in an undersea thermal vent that lacks a nucleus is Archeae.
<h3>What is domain?</h3>
Domain in biology refers to the highest rank in the classification of organisms, above kingdom.
The three domain of organisms are as follows:
- Prokarya or Bacteria
- Archaea
- Eukarya
Members of Prokarya and Archaea do not possess a membrane-bound nucleus, however, the major difference between them is that members of domain Archaea are found in extreme habitats e.g. hot regions.
Therefore, the domain of the new species of unicellular microorganism in an undersea thermal vent that lacks a nucleus is Archeae.
Learn more about domain at: brainly.com/question/13113489
#SPJ2
Answer is B
It is because I did this and got it right and also oil is a liquid so it will immediately stop whatever is coming.
A. A <u>wind vane</u> measures the wind direction and <u>anemometer</u> measures the wind speed.
B. When rising air cools, it can lead to clouds and precipitation because cool air can hold less water vapor.
C. Sinking air <u>warms</u> and causes evaporation of clouds, thus fair weather
D. Isobars means bars of equal pressure, ‘iso’ meaning ‘equal’ and ‘bar’ representing a unit of pressure, so together isobar means bars of equal pressure. Isobars or lines of equal pressure may be packed together indicating a <u>strong</u> pressure gradient
E. Pressure gradient is the difference in pressure between high and low pressure areas. The strongest winds are in areas where the pressure gradient is the <u>greatest</u>.
Explanation:
A wind vane is an instrument which spins according to the wind direction.
An anemometer is a meteorological instrument that measures the wind speed, direction and pressure.
Rising air cools while the sinking air warms according to the adiabatic cooling/warming principles. Warm air holds more moisture than cold air.
Isobars are unique features on a weather map represented by lines connecting areas with equal pressure gradients. According to the pressure gradients, the isobar spacing is arranged.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer: In the mitochondria.
Explanation: The enzymes of fatty acid break down are located in the mitochondrial matrix. Fatty acid break down occurs in the mitochondria in a process known as beta oxidation. Beta oxidation involves the break down of fatty acids to acetyl CoA. Beta oxidation involves the oxidative removal of successive two carbon units in the form of acetyl CoA .
Acetyl CoA produced enters into the citric acid cycle for the generation of ATP.
