1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nostrana [21]
3 years ago
10

How would clearing a forest and replacing it with corn affect an environment?

Biology
1 answer:
zaharov [31]3 years ago
7 0
You would lose alotof the oxygen the forest trees produced but you would at least have something delicious to eat in exchange.
You might be interested in
You identify a new species of microorganism in an undersea thermal vent. The microbe is a single cell organism that lacks a nucl
Alenkinab [10]

The domain of the new species of unicellular microorganism in an undersea thermal vent that lacks a nucleus is Archeae.

<h3>What is domain?</h3>

Domain in biology refers to the highest rank in the classification of organisms, above kingdom.

The three domain of organisms are as follows:

  • Prokarya or Bacteria
  • Archaea
  • Eukarya

Members of Prokarya and Archaea do not possess a membrane-bound nucleus, however, the major difference between them is that members of domain Archaea are found in extreme habitats e.g. hot regions.

Therefore, the domain of the new species of unicellular microorganism in an undersea thermal vent that lacks a nucleus is Archeae.

Learn more about domain at: brainly.com/question/13113489

#SPJ2

6 0
3 years ago
Friction is the force that one surface exerts on another when they rub together. Friction works in the direction opposite to the
Ghella [55]

Answer is B

It is because I did this and got it right and also oil is a liquid so it will immediately stop whatever is coming.

5 0
4 years ago
A. A ________ _______measures the wind direction and an ____________
nignag [31]

A. A <u>wind vane</u> measures the wind direction and <u>anemometer</u> measures the wind speed.

B. When rising air cools, it can lead to clouds and precipitation because cool air can hold less water vapor.

C. Sinking air <u>warms</u> and causes evaporation of clouds, thus fair weather

D. Isobars means bars of equal pressure, ‘iso’ meaning ‘equal’ and ‘bar’ representing a unit of pressure, so together isobar means bars of equal pressure. Isobars or lines of equal pressure may be packed together indicating a <u>strong</u> pressure gradient

E. Pressure gradient is the difference in pressure between high and low pressure areas. The strongest winds are in areas where the pressure gradient is the <u>greatest</u>.

Explanation:

A wind vane is an instrument which spins according to the wind direction.  

An anemometer is a meteorological instrument that measures the wind speed, direction and pressure.

Rising air cools while the sinking air warms according to the adiabatic cooling/warming principles. Warm air holds more moisture than cold air.  

Isobars are unique features on a weather map represented by lines connecting areas with equal pressure gradients. According to the pressure gradients, the isobar spacing is arranged.

4 0
4 years ago
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
In eukaryotes fatty acid breakdown occurs where
makvit [3.9K]

Answer: In the mitochondria.

Explanation: The enzymes of fatty acid break down are located in the mitochondrial matrix. Fatty acid break down occurs in the mitochondria in a process known as beta oxidation. Beta oxidation involves the break down of fatty acids to acetyl CoA. Beta oxidation involves the oxidative removal of successive two carbon units in the form of acetyl CoA .

Acetyl CoA produced enters into the citric acid cycle for the generation of ATP.

8 0
3 years ago
Other questions:
  • Which of the following would not inhibit micturition?
    14·1 answer
  • Quiz which condition could lead to drawdown below the level of existing wells?
    7·1 answer
  • An ______ is an animal that obtains its body heat from the environment ectotherm outertherm perifitherm endotherm
    14·2 answers
  • Explain the process that creates wind
    9·2 answers
  • A common misconception is that a virus is a living organism. Why is this statement incorrect? Explain the concept correctly. Why
    9·1 answer
  • The teeth of grain-eating animals (such as horses) are usually broad and ridged. This makes the teeth suitable for grinding and
    15·1 answer
  • Definitely whether these substances are solid liquid or gas
    9·1 answer
  • Describe one of the three types of volcanoes we discussed today.
    8·1 answer
  • Where can volcanoes form?
    7·1 answer
  • 11. What genetic syndrome is shown in this picture?*
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!