3 years ago

Making Comparisons Read the description of how

Biology

1 answer:

Kay [80]3 years ago

5 0

Answer:

Fossil fuels are produced by the same geological processes.

Explanation:

Fossil fuels form when organic matter which has been buried in the Earth over a long period of time is subjected to heat and pressure over a long period of time. Heat and pressure are both critical components for the formation of a fossil fuel. The process of the formation of fossil fuel is the same today as it was in the past. The geological processes are the same for the formation of fossils.

You might be interested in

A farmer uses triazine herbicide to control pigweed in his field. For the first few years, the triazine works well and almost al

erik [133]

Answer:

A) Natural selection caused the pigweed to mutate, creating a new triazine-resistant species.

Explanation:

Due to constant use of triazine, the weed will build resistance to it over time unlocking the herbicides codes and making it ineffective.

Natural selection will play out allowing this weeds to bring about a sudden change in their genome that will become resistance, this resistance breed is what will then be produced over time because mutation is heritable and the herbicide then becomes ineffective and the weed continues to multiply and increase in volume.

4 0

3 years ago

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C

topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0

3 years ago

The two polynucleotide chains in a dna molecule are attached to each other by:

erastovalidia [21]

Phosphodiester bonds

5 0

3 years ago

According to modern cell theory, all cells arise from pre-

Lemur [1.5K]

By option A cell division.

5 0

3 years ago

I need help I have no clue what I'm doing!

OLga [1]

Use the punnett square to help you. girls are xx boys are xy. they get 50 from mother and 50 from father

7 0

4 years ago