1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
5

Sienna made a chart listing different kinds of mollusks.

Biology
1 answer:
igomit [66]3 years ago
8 0

Answer:

Im pretty sure its C. But correct me if im wrong

X: Gastropods

Y: Cephalopods

Z: Bivalves

Explanation:

You might be interested in
Place the following terms in the correct order from SMALLEST to LARGEST:
QveST [7]
DNA, nucleosome, coils, supercoils, chromosome.
5 0
3 years ago
What is An estuary according to biomes
Luda [366]

An estuary is an area where a freshwater river or stream meets the ocean. In estuaries, The salty ocean mixes with a fresh water river, resulting in brackish water. Brackish water is someone salty, but not as salty as the ocean. An estuary may also be called a bay, lagoon, sound, or slough.

3 0
3 years ago
How many chromosomes do haploid cells have?
Oxana [17]
Diploid cells = 2n = 46
Haploid cells = n = 23

therefore, there are 23 chromosomes in haploid cells.
8 0
3 years ago
PLZ HELP I NEED HELP
JulsSmile [24]

Explanation:

Winds are caused by low and high pressure zones, mainly due to temperature differences of atmospheric air in different regions. Air moves from high to low-pressure zones causing winds.

Local winds, as the name suggests, are winds due to regional temperature differences. An example is sea breeze caused by temperature differences over land and sea in the region.

Global winds, on the other hand, are caused by large pressure systems across the planet. These are mainly caused by differences in how the sunlight ‘hits’ the planet at different latitudes – due to earth’s spherical nature- causing differential heating of the earth. These winds travel great distances causing trade winds.

6 0
3 years ago
Read 2 more answers
What 4 things are attached to the center carbon in an amino acid?
Alinara [238K]

The carbon attached to the alpha carboxyl and the alpha amino group is known as the alpha carbon. 2. All amino acids except glycine have four different groups attached to the alpha carbon. As a result, all amino acids have at least one asymmetric center (the alpha carbon).

3 0
3 years ago
Other questions:
  • Ecology is the study of the differences between plants and animals in their environment
    10·1 answer
  • What happens when your diaphragm relaxes and moves upward?
    14·1 answer
  • Characteristics of membrane protein:____________.
    7·1 answer
  • Using a standard set of steps to answer or solve a problem is called?​
    11·1 answer
  • What would a burning animal fiber smell like ?
    12·2 answers
  • Fill in the blank: The variable that is changed by the scientist in an experiment is the
    5·1 answer
  • Larva stage of insect miving in mass is called​
    13·1 answer
  • How is the ocean explored?
    7·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Drag each tile to the correct location on the image.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!