1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lorico [155]
3 years ago
9

One way that mining for mineral resources damages land is by?

Biology
2 answers:
ValentinkaMS [17]3 years ago
6 0
Well it does increase soil erosion.
sasho [114]3 years ago
6 0

The correct answer is D. Increasing soil erosion

Explanation:

Mining refers to the process of extracting minerals such as coal, chalk, limestone, etc that are usually placed on underground deposits. Because of this, mining often involves excavation, although other methods use substances and chemicals to extract the mineral. In all of this cases, the natural properties of the soil are negatively affected as vegetation is often removed along with multiple soil layers, this leads to soil erosion due to the damage in the soil and the lack of vegetation that make the soi dry and in most case infertile. Therefore, one way mining for mineral resources damages land is by increasing soil erosion.

You might be interested in
In the process of aerobic respiration, the Krebs Cycle (Citric Acid Cycle) occurs in the
Jlenok [28]
The Kerbs Cycle occurs in the, D.mitochondria 
5 0
2 years ago
Read 2 more answers
PLEASE HELP!
Simora [160]

Answer:

POLUTION

Explanation:

4 0
2 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Nhóm thức ăn nào sau đây giàu chất đạm?
dybincka [34]

Answer:

đù việt nam

Explanation:

thịt lợn trứng gà sữa cá

3 0
3 years ago
In a _____ circuit, the current is the same everywhere.​
UNO [17]

Answer:

A series circuit

Explanation:

In a series circuit, the current is the same everywhere.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which structure receives food directly from the stomach, where it is mixed with strong digestive juices from the liver and pancr
    15·1 answer
  • Which object is created during the formation of a start
    11·1 answer
  • Which structure would be most beneficial for a plant in a tundra biome? A. shallow roots that do not reach the frozen soil B. de
    12·1 answer
  • a point mutation occurs in a sex cell of an adult rabbit. The gene affected by the mutation is responsible for proteins that bui
    7·2 answers
  • A sediment that has a diameter of 0.8 cm would be considered
    8·1 answer
  • Which process moves water molecules across the membrane of a cell?
    7·2 answers
  • What is the second most abundant element in the human body?
    11·2 answers
  • The giant african land snail is an invasive species that is also the largest snail ons earth what is most likely consequence of
    6·1 answer
  • Why don’t we have lunar eclipses every month ?
    5·2 answers
  • As a scientist, what are some questions you could answer with a microscope but not with your eyes alone?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!