1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
11

One purpose of sports drinks is to replace fluid and electrolytes that are lost through sweating.

Biology
2 answers:
daser333 [38]3 years ago
8 0
 the answer to the question is a. true
Stella [2.4K]3 years ago
7 0
I believe the answer is true
You might be interested in
What is the percent by mass water in calcium chloride hexahydrate?
mixas84 [53]

Answer:

the answer is 3%

5 0
2 years ago
Read 2 more answers
Which one of the following is a difference between a normal cell and a cancer cell?
MAVERICK [17]
What are the following?

6 0
3 years ago
Read 2 more answers
Which part of the root allows it to grow deep inside the soil in search of water? A. epidermis B. cortex C. root tip
Zepler [3.9K]
The root tip allows the plant to grow deeper into the soil
3 0
3 years ago
(Will Upgrade "AGAIN")
Serga [27]
Sound travels faster in solid
4 0
3 years ago
The number of mosquitoes at the beginning of the summer was 4,000. There were 500 born and 550 died. What is the growth rate of
Studentka2010 [4]

Answer:

-50

Explanation:

500-550

6 0
3 years ago
Other questions:
  • Which statement explains why hydrogen bonds are able to form between water molecules?
    6·1 answer
  • How are earthquakes and volcanoes similar or related and how are they different? please help essay due tomorrow
    13·1 answer
  • if two eukaryotes participate in lateral gene transfer what will this do to the overall genetic variation of species
    13·2 answers
  • Although fertilizers have been very important in increasing the food supply, there have
    9·1 answer
  • In humans, MITOSIS directly accomplishes all of the following EXCEPT
    10·1 answer
  • 8. If a lawn is fertilized and it doesn't rain, the grass often dies. Why?
    9·1 answer
  • Please help Students made a claim that living things are made of cells, and non-living things are not. Which or these would be t
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which process produces four haploid cells?
    9·1 answer
  • Describe two effects that ingesting microbeads has on aquatic organisms.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!