1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
13

In wich layer of the earth do the deepest of earthquakes occur

Biology
1 answer:
Ann [662]3 years ago
3 0
Earthquakes occur all the time all over the world, both along plate edges and along faults. Most earthquakes occur along the edge of the oceanic and continental plates. The earth's crust (the outer layer of the planet) is made up of several pieces, called plates.
You might be interested in
From which type of cells did ulticellular organisms arise?
slava [35]
Multicellular organisms arose from E<span>ukaryotes, a single celled organism.</span>
3 0
3 years ago
What can inferred from the graph?
arlik [135]
May I see the graph in image form
8 0
3 years ago
When comparing protein-coding DNA sequences of similar genes in related species, you see that some of the sequences are longer i
Rina8888 [55]

Answer:

Homolog genes with sequence identity often exhibit differences in length associated with size variations in the intronic sequences

Explanation:

In eukaryotic organisms, genes are composed by 1- coding sequences (i.e., exons) that are transcribed into precursor mRNAs, and 2-noncoding regions (or introns), which are not transcribed but contain sequences involved in the control of gene expression

4 0
3 years ago
What type of neurone is neurone x
anyanavicka [17]

Neurone X should be motor neurone.


Motor neurone should be the type of neurone after relay neurone. Impulses travel from the relay neurone then to the motor neurone, and the motor neurone passes messages for the effectors usually in reflex actions, where effectors can be muscles or glands.



8 0
3 years ago
Name an organism that could reproduce either sexually or asexually.
poizon [28]
Seastars/starfish or fungi
7 0
3 years ago
Read 2 more answers
Other questions:
  • which of the following shows the correct order in which genes are expressed? a. DNA to rna to proteins. b. rna to DNA to protein
    12·2 answers
  • A follow-up study was conducted on 3000 military troops deployed at an atomic test site in Nevada to detect the occurrence of le
    9·1 answer
  • The air component in soil provides plants with the what needed for photosynthesis
    13·1 answer
  • Which of the following are matched correctly?
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How do consumers get the chemical energy they need to live and grow?
    6·1 answer
  • ONE FOOD CHAIN that was affected by the introduction of wolves and model it
    7·1 answer
  • Which definition is Migration?
    13·2 answers
  • Ron has a gold watch and a silver ring. What can you tell Ron about these items?
    9·1 answer
  • Describe why and how latitude affects temperature.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!