1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
3 years ago
9

Which of these hormones increases ca++ concentration and slightly decreases phosphate ion concentration in the blood?

Biology
1 answer:
S_A_V [24]3 years ago
4 0
Parathyroid   hormones (PTH)   increases the        Ca++  concentration  and slightly   decreases   phosphate  ion concentration  in the blood.
   When   Parathyroid  hormone increases, the body  release  more  calcium   from  bones into  blood    which  lead to the increase  in calcium concentration in  the blood. 
    The  parathyroid  hormone increase  in the other hand  led to slightl
y  decrease  in phosphate  ions since   it reduces  the reabsorption  of phosphate    from  proximal  tubule   of the kidney
You might be interested in
After three days of taking a selective serotonin reuptake inhibitor (SSRI), Derrek is disappointed because he is not feeling any
Evgesh-ka [11]

Answer:

Weeks.

Explanation:

Selective serotonin reuptake inhibitors are common antidepressants prescribed for patients with depression and anxiety disorders. However, these medications do not have an immediate effect. They usually have full effect within weeks, depending on the patient.

This delay, can be explained by the mechanism of action of these drugs. Selective serotonin reuptake inhibitors act by blocking the serotonin transporter which transports serotonin into the brain cells.This results in more being available outside the cells where it has it effects.

SSRIs don't work instantaneously because they do not target the transporter directly. They rather, bind to the DNAs that produce the transporter and therefore makes them less active and this leads to lower amount of transporters available. This process takes time.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A true-breeding pea plant with round, green seeds was crossed to a true-breeding plant with wrinkled, yellow seeds. Round and ye
Nat2105 [25]

Answer:

See explanations

Explanation:

Gregor Mendel developed the model of heredity that now bears his name by experiments on various charactersitics of pea plants: height (tall vs. Short); seed color (yellow vs. Green); seat coat (smooth vs. wrinkled), etc. The following explanation uses the tall/short trait. The other traits Mendel studied can be substituted for tall and short.

Mendel started out with plants that "bred true". That is, when tall plants were self-pollinated (or cross-pollinated with others like them), plants in following generations were all tall; when the short plants were self-pollinated (or cross- pollinated with others like them) the plants in following generations were all short.

Mendel found that if true breeding Tall [T] plants are crossed (bred) with true breeding short [t] plants, all the next generation of plants, called F1, are all tall.

Next, he showed that self-pollinated F1 plants (or cross- pollinated with other F1 plants) produce an F2 generation with 3/4 of the plants tall and 1/4 short.

A. 1/4 of the F2 generation are short plants, which produce only short plants in the F3 generation, if they are self- pollinated (or crossed with other short F2 plants;) these F2 plants breed true.

B, 1/4 of the F2 generation (1/3 of the tall plants) are tall plants that produce only tall plants in the F3 generation, if they are self-pollinated; these tall F2 plants breed true.

C. 1/2 of the F2 generation (2/3 of the tall plants) are tall plants that produce 1/4 short plants and 3/4 tall plants in the next [F3] generation, if they are self-pollinated. This is the same proportion of tall to short that F1 plants produce.

3 0
3 years ago
Two populations of frog species are separated by a group of mountains. A tunnel is built through the mountains, through which so
Vinvika [58]

Answer:

Post reproductive isolation → Hybrid sterility

Explanation:

The biological concept of species states that individuals of a species can not mate and reproduce with individuals of another species. But if they get to reproduce, the progeny will not be viable or fertile. There will not be any reproductive success.

There are different reproductive isolation mechanisms, which are barriers that inhibit or interrupt the genetic flow between different species.

Reproductive barriers are isolation mechanisms that prevent mating between two or more species. The prezygotic mechanism avoids fertilization between individuals of different species, while the postzygotic mechanism impedes the zygote to develop and reach the adult stage.

Postzygotic mechanisms or barriers include

  • Hybrid inviability,  
  • Hybrid sterility,
  • Hybrid decreased viability or fertility,
  • Cytoplasmic interactions.

In the exposed example, it seems that the mountains separating the frogs´ populations made a place for the development of postzygotic barriers, specifically hybrid sterility. Frogs from one population get to mate and produce offspring with the frogs of the other population, but their progeny is sterile.  

6 0
3 years ago
What occurs in the menstral cycle day 1-4 for unfertilized egg in ovary?
Sladkaya [172]
On day one the levels of oestrogen and progesterone are low, having dropped quickly at the end of the last cycle. Low oestrogen level causes FSH release from the pituitary gland.
3 0
4 years ago
Other questions:
  • What are DNA and ran both called
    9·2 answers
  • What are some advantages and disadvantages of
    9·2 answers
  • What effect does temperature have on the characteristics of magma
    9·2 answers
  • In both photosynthesis and respiration, _______ synthesis is coupled to the diffusion of protons across a membrane from high to
    13·1 answer
  • Which of the following is true regarding membrane asymmetry? Carbohydrates attached to membrane lipids are usually found on the
    13·1 answer
  • Can someone please help me quick
    13·1 answer
  • Properties of water worksheet answe
    6·1 answer
  • Almost all the South American and Central American
    15·1 answer
  • Tails face each other within the bilayer and form a region that
    11·1 answer
  • Sun,maple trees, grass. Explain how the flow of the matter and energy occurs in the system. Make the system by choosing several
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!