1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
13

In which organism does the respiratory system bring air directly near all the body's cells so that the circulatory system is not

a main transporter of oxygen to the cells? A. tree frog B. mosquito C. shark D. lion
Biology
2 answers:
Artemon [7]3 years ago
8 0
A. Tree , because trees release oxygen through photosynthesis
Artist 52 [7]3 years ago
3 0
A.tree we release carbon dioxide nd the trees absorb it and produce oxygen
You might be interested in
The products of combustion include ________.
MakcuM [25]

The choice is D - both A and C

3 0
4 years ago
Read 2 more answers
The evolution of a long neck in giraffes is an example of:
Y_Kistochka [10]
<span>The evolution of a long neck in giraffes is an example of natural selection in that the giraffes with long necks would be able to eat more leaves from higher trees and thus be more successful.</span>
3 0
4 years ago
Imagine you are a pathogen. You are trying to invade a human, and you find yourself moving through barriers. Describe the barrie
Artyom0805 [142]
The different barriers that you have to go through are the different organs of the immune system. These are the lymphoid organs, thymus, and bone marrow. The secondary wall that you have to go through are the lymphatic tissues which include the lymph nodes, adenoids, skin, liver, tonsils, spleen, and the lymph vessels. 

At all times, these systems work hand-in-hand so that the body can protect itself in order for it to survive
8 0
3 years ago
Read 2 more answers
The graph of a function never has two different points with the same x-coordinate because_
storchak [24]

Answer:

a the graph of a function I hope it will help you please follow me

6 0
4 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • A student cuts her hand during her gym class. The next day the cut is red and inflamed. What is the likely cause?
    6·2 answers
  • Select all that apply.
    6·2 answers
  • What is the name of the clusters of lymphatic nodules located in the lining of the small intestine?
    6·1 answer
  • Where are fossils rare
    7·2 answers
  • The scientific method often begins by asking questions about the natural world. Which of the following is an example of a scient
    15·1 answer
  • How does the watershed affect the water body into which it drains and how do humans impact this water?
    12·1 answer
  • According to the law of supply and demand, if the demand for a product suddenly goes up faster than the supply, which of the fol
    10·1 answer
  • Question: Explain why you think taking care of the earth and its resources is more important than ever.
    6·1 answer
  • What helps meteorologists to forecast the weather?
    15·2 answers
  • 3 functions of lipids
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!