Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
<span>The oxygen circulates in your body, gets used up, and carbon dioxide is the result. The carbon dioxide then travels with your blood back to your lungs and then it is exhaled. </span>
The lipid bilayer is a membrane composed of two layers of phospholipids. A phospholipid is a molecule made up of a polar phosphate head and non-polar fatty acid chains.
- The diagram makes reference to the different components of the lipid bilayer.
- The main components of the lipid bilayer are phospholipids and cholesterol.
- The lipid bilayer is also composed of different proteins such as transmembrane integral proteins (channels) and peripheral proteins.
The structures observed in the diagram are as follow:
- Phospholipid molecule (A). Function: structural.
- Polar (hydrophilic) head of the phospholipid (B). Function: stabilize the membrane by its interaction with water.
- Integral glycoprotein (C). Function: signaling pathways and cellular communication
- Oligosaccharide attached to a peripheral protein (D). Function: form the glycocalyx.
- Cholesterol (E). Function: provide fluidity to the lipid bilayer.
- Integral protein (F). Function: signaling pathways and cellular communication.
- Phospholipid bilayer (H-I). Function: Semipermemable barrier that separates the intern cell medium from the surrounding environment.
- Transmembrane integral protein (protein channel) (G). Transport of materials.
Learn more in:
brainly.com/question/1620189?referrer=searchResults
Answer:
According to the sliding-filament model of contraction, the muscle contraction occur due to the myosin heads propel the actin myofilaments toward the center of the sarcomere. This pulls the Z disks closer together, shortening sarcomere and the entire muscle
Explanation:
In the muscle fiber there are two proteins that facilitate the process of contraction, myosin and actin. Myosin is thicker and more abundant than actin, and its interaction is responsible for the process of muscle contraction.
Both molecules, myosin and actin, form bonds -called cross bridges- where the myosin heads produce the mobilization of actin towards the center of the sarcomere. Z discs are associated with actin myofibrils, so they come close, and promote the shortening of the sarcomere.
This process requires the action of calcium ions, which depolarize the muscle cell and consume energy in the form of ATP.
It should be noted that the myosin and actin molecules do not change their length, but their action causes the muscle fibers to shorten during contraction.
Learn more:
Types of muscle contraction brainly.com/question/7117064