1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
9

The right and left coronary arteries are the first branches off the a. aorta. b. superior vena cava. to. pulmonary trunk. d. pul

monary veins. g
Biology
1 answer:
Zepler [3.9K]3 years ago
8 0

Answer:

answer is A aorta

Explanation:

aorta is the answer

You might be interested in
The major source of building blocks for building new muscle and tissue are found in foods that contain _____.
balandron [24]

a) Proteins 

Hope this helps

8 0
3 years ago
Read 2 more answers
Which of these would require signal transduction?
Evgesh-ka [11]

Answer

(a) is the correct option

explanation :

Hair cells are the sensory receptors of both the sound related framework. hair cells distinguish development in their environment any damage in these hair cells can bring about the lowering hearing capability, and this defect is changeless. calcium ion is an imperative part of the hair cells to adjust the intensification of the signal.

8 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What is the difference between osmosis and diffusion
Vinil7 [7]

Answer:

first question:  3. osmosis is a kind of diffusion that involves the movement of water

2nd question:  1. it allows carbon dioxide to move in and out of the cell

Explanation:

5 0
3 years ago
It is possible for a mix up to occur between fictitious and factual information.
jasenka [17]
In my opinion yes, because sometimes fictitious information can have information that may seem factual or possibly have something in it to make it look factual. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the general population limit of a galaxy group?<br> 5<br> 50<br> 100<br> 1000
    13·1 answer
  • How many valence shell electrons does the element carbon have
    6·1 answer
  • Summary of the sympathetic nervous system?
    8·1 answer
  • True regarding sexual reproduction as a method of producing offspring
    6·1 answer
  • What is a classification key? dichotomous key?
    9·1 answer
  • How is your community like the human body, give two examples
    11·2 answers
  • What is the name of a baby goat?
    8·2 answers
  • Animal wastes that runoff into water is an example of which types of pollution? question 3 options: bacterial &amp; chemical nut
    10·1 answer
  • What is the main function of the organs thyroid gland, adrenal glands, and pancreas?
    5·1 answer
  • When food reaches the small intestine, bile is released from the pancreas. true false
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!