A glucose molecule is the monomer of starch and cellulose
Answer:a u have both ur parents genes Dd and Dd
Explanation:
Answer:
Juvenile rheumatoid arthritis
Explanation:
Arthritis is a term used to refer a group of diseases that affects the joints such as knees, wrists and fingers.
Juvenile rheumatoid Arthritis is an autoimmune disorder that affects children which means the body attacks itself by mistakenly identifying its own cells as foreign .
The cause of this response is not yet known.
Some of the symptoms of the disease include stiffness, pain, joint swelling, skin rush, fever, slowed growth and fatigue.
It has no cure but in some cases children seem to outgrow the disease.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Glucose
Glucose, a small polar solute, uses a membrane transporter (a protein carrier) to cross the plasma membrane via facilitated diffusion. In simple diffusion, small nonpolar and lipid-soluble substances (including gases) diffuse directly through the lipid bilayer.
