1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
6

Which sentence supports the statement that complex, multicellular organisms are made up of specialized cells that each perform d

ifferent functions for the body? A. Human liver cells make proteins that promote homeostasis that neurons do not. B. Different species of bacteria have different shapes and structures to their cells. C. The DNA in the cell nucleus of chimpanzees and humans are 98% identical. D. Prokaryotes do not have nuclei, but they can still carry out the basic functions of life.
Biology
1 answer:
mart [117]3 years ago
5 0

The correct option is A.

Multicellular organisms are made up of many different cells. Each type of cell perform a unique basic function which another type of cell can not perform. Cells are usually equipped to carry out their functions by their components, structures and sizes.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
If an egg was 20% of a birds body weight how much does it weigh if the bird was 10 pounds
Ira Lisetskai [31]
10*0.2=2lb egg

8lb bird
7 0
3 years ago
The Moon takes one year to complete its phases. <br> True or False
Anon25 [30]

Answer:

False

Explanation:

the moon takes about a month to go through all of its stages.

8 0
3 years ago
Read 2 more answers
Where does RNA polymerase begin transcribing a gene into mRNA?
IrinaK [193]

Answer:

The correct answer will be option-B

Explanation:

The process of transcription transcribes the sequence of the bases of genes present on DNA to mRNA which acts as a messenger molecule for the protein synthesis.

The process of transcription is mediated by the presence of enzymes which includes the main transcription enzyme called RNA polymerase. RNA polymerase attaches nucleotides to RNA strand.

The transcription process initiates in three stages: initiation, elongation and termination.  

The initiation process begins when RNA polymerase binds to the promoter nucleotide sequence which is present at the start site or the upstream on DNA towards 5' end.

Thus, Option-B is the correct answer.

6 0
3 years ago
What does the cell nucleus contain
krok68 [10]

Answer:

A) chromosomes

Explanation:

7 0
3 years ago
Other questions:
  • In the diagram below, which of the following represents the equilibrium? 1)a 2)b 3)c 4)d
    13·2 answers
  • Secondary succession occurs when organisms begin to colonize an environment with no soil and no existing organisms. Please selec
    7·1 answer
  • Consider that it takes, on average, 24 hours (or 1,440 minutes) for each onion root tip cell to complete the cell cycle. You can
    13·1 answer
  • Liposomes consist of ________ bilayers that enclose an aqueous compartment where drugs can be contained for delivery to specific
    10·1 answer
  • If mean global temperature keeps on increasing, which type of species will most likely go extinct? Generalist or specialist?
    13·1 answer
  • Describe the events by which depolarization of a smooth muscle cell results in contraction and explain why smooth muscle contrac
    7·1 answer
  • The goal of meeting economic and humans needs is to improve blank of life
    12·1 answer
  • Consider the relevance, significance, advantages and disadvantages, and strengths and weaknesses of having a cell-mediated and a
    13·1 answer
  • Why was Aristarchus’s model not accepted? Select two options.
    8·1 answer
  • What are the benefits of planting only native species when implementing rain gardens, no-mow native meadows, and/or tree plantin
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!