1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Over [174]
3 years ago
5

What organelle do frog RBCs have that human RBCs do not and explain why?

Biology
1 answer:
Lina20 [59]3 years ago
4 0
Frog RBCs contain a DNA-bearing nucleus that is visible in the center of the cell. Human RBCs do not possess nucleus along with other cell organelles such as mitochondria, Golgi apparatus and endoplasmic reticulum in order to accommodate greater amount of haemoglobin in the cells. Denucleation of rbcs is an adaptation, Which makes the mammalian red blood cell effective at transporting oxygen/eliminating CO2.
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is worse? A substitution or a deletion? Why?
Komok [63]
Deletion because it worse then a substitution since your deleting something
5 0
2 years ago
A gland secretes enzymes through a duct onto the surface of a body part. Which gland is it most likely to be?. . A.pituitary gla
lidiya [134]
I believe the correct answer among the choices listed above is option B. A gland secretes enzymes through a duct onto the surface of a body part is a salivary gland. It is under the classification of exocrine glands. Hope this answers the question.
7 0
3 years ago
Read 2 more answers
Which of the following represents the correct format for the scientific name of an organism? Which of the following represents t
scZoUnD [109]

Answer:

<em>Staphylococcus aureus</em>

Explanation:

According to the rule of binomial nomenclature, the name of the organism is written in two parts that are-

1. Generic name- The first name which signifies the genus of the organism, the word represents the noun of the organism, the first letter of the word is always uppercase that is like in the "Staphylococcus"

2. The specific epithet-the second name of the organism represents the species which is usually a noun, and the first letter of species is always written in lowercase like in the aureus.

The scientific name should be written either in the italicised form or if not possible to write in the italicised form than underline the name.

Thus, <em>Staphylococcus aureus </em>is correct.

4 0
3 years ago
What happens to the average kinetic energy of a substance as its temperature increases
Molodets [167]

Answer:

When the average kinetic energy of the molecules goes up (a rise in temperature), the average speed of the molecules increases. And lower average kinetic energy of the molecules means they have lower speed.

hope this helped !! ✨

5 0
2 years ago
Other questions:
  • What measures a materials resistance to the flow of electricity ?
    10·2 answers
  • One species benefits and the other species is neither harmed nor helped.
    13·2 answers
  • Amobarbital sodium has been prescribed for a client with dissociative amnesia. the nurse determines that teaching has been succe
    13·1 answer
  • DNA is packaged in the nucleus of the cell in a structure called ________________ in which the DNA coils around proteins called
    6·2 answers
  • What is the correct sequence of factors involved in blood clotting?
    14·2 answers
  • BRAINLIESTTT ASAP!!
    6·1 answer
  • How do organisms use flagella to cause movement?
    13·1 answer
  • Which type of plate boundary produces seafloor spreading?
    9·1 answer
  • How do engineers use stem to create roller coasters
    8·2 answers
  • Two examples of chemical energy in the process of cellular respiration
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!