1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
12

How do the Golgi apparatus, the endoplasmic reticulum, and the ribosomes all work together?

Biology
2 answers:
umka21 [38]3 years ago
7 0

The endoplasmic reticulum takes the proteins that are made by the ribosomes and folds them into sacs that are called cisternae. It then transports these folded proteins to the Golgi apparatus.

pentagon [3]3 years ago
7 0
To form a protein to golgi apparatus
You might be interested in
If you were to repeat the Meselson Stahl experiments, but rather than use N15 and N14, you use P32 and P31, how would the result
bonufazy [111]

Answer:

The correct answer will be option-C

Explanation:

The CsCl gradient centrifugation in Meselson Stahl experiments is done to separate the bands of the DNA containing isotopes on the basis of difference in the density.

In the experiment, bacterial cultures were grown in the medium of 15N and 14N but if we repeat the experiment with P32 and P31 instead of 15N and 14N and centrifugation is performed then the banding pattern will be the same as of the previous experiment as the method of the replication is same that is semi-conservative.

Thus, Option-C is the correct answer.

4 0
3 years ago
Most adult humans consume about 2000 cal of food energy each day. What might happen to the energy firm this food?
kirill115 [55]

Answer:

The energy which is taken by consuming food to perform different functions such as movement, exercise, breathing and thinking etc.

Explanation:

The energy from the food is released in the process of respiration. In respiration, energy is released in the form of ATP due to the breakdown of glucose molecules in the mitochondria of the cell. This energy is used by the body in different activities.

8 0
3 years ago
What happens after
Mamont248 [21]

Answer:

The DNA strand breaks apart (splits in half, if you will) in order for the translation process to begin.

8 0
2 years ago
Which of the following is most lateral?
Dmitriy789 [7]

Answer:

the answer is xiphoid process

7 0
3 years ago
PLS I need someone to upload a photo of the answer!
podryga [215]

Answer:

See the file bellow

Explanation:

Download docx
7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • One of the greatest expenses involved with the use of hazardous materials in industry is the _____.
    14·2 answers
  • what are the four types of stem cell? and give an example of each type, and explain how much each type can differentiate.
    5·2 answers
  • Structures pass through lesser sciatic foramina?​
    14·1 answer
  • Moving water has been utilized in hydroelectric plants to _________________, but in recent years negative environmental conseque
    13·2 answers
  • A father and mother that are both heterozygous dominant for tongue rolling mate. Tongue rolling is a dominant trait. answer any
    11·1 answer
  • If the answer is right i will give Brainlyiest answer.
    11·2 answers
  • Which of the following is an example of evolution?
    7·1 answer
  • What happens to food material that cannot be digested?
    9·2 answers
  • An increase in earths temperature from the build up of carbon dioxide and other gases in the atmosphere is called... global warm
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!