1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
7

Second growth timber refers to select one:

Biology
1 answer:
AlexFokin [52]3 years ago
4 0
Answer is: <span>c. trees which have regenerated after logging.
</span>Second growth timber is trees grown after a forest has been cutdown and then has grown a second time. Second trees <span>have trees closer spaced than primary forests and </span>need 150-500 to gain primary characteristics of primary forest.
You might be interested in
Which of the following are part of the chemiosmotic coupling model? Protons are pumped out of the mitochondrial matrix into the
Lina20 [59]

The correct answer is: Protons are pumped out of the mitochondrial matrix into the intermembrane space

Chemiosmosis can be described as movement of ions across a selectively permeable membrane, down their electrochemical gradient. It occurs during the cellular respiration within mitochondria and it is involved in ATP synthesis (oxidative phosphorylation via ATP synthase).

Electrons from electron carriers (NADH and FADH) donate electrons to the electron transport chain and that causes changes in protein complexes of electron transport chain. As a consequence, protein complexes pump H+ across a selectively permeable cell membrane from the mitochondrial matrix into the intermembrane space of mitochondria.  

H+ can only get back and pass through the inner mitochondrial membrane with the help of ATP synthase (down their electrochemical gradient). ATP synthase turned by the force of the H+ diffusing through it forms ATP by adding a phosphate to ADP.

4 0
3 years ago
Help with answering this question!
svlad2 [7]

Answer:

coyote and jackal

Explanation:

branches are closer together on the tree

5 0
2 years ago
Could someone please answer this question?
77julia77 [94]

Answer: Genes are segments of deoxyribonucleic acid (DNA) that contain the code for a specific protein that functions in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus.

Explanation:

7 0
3 years ago
Read 2 more answers
The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most s
Nikitich [7]

Answer:

The six codons for arginine are the following:

GCA, GCG, GCT, GCC, TCT, TCC

A) Considering the individual bases in each codon, three mutations are possible at each base position. Hence, 3 × 3 × 6 = 54 mutations are possible.

B) Considering the mutations at the 3rd base: 3 × 4 + 1 × 2 = 14 of these mutations are silent mutations.

C) Lysine codons are the following:

TTT, TTC

There are two possible mutations that can give a lys codon.

Hope that answers the question, have a great day!

8 0
3 years ago
Photosynthesis Puzzle #3
Radda [10]

Answer:

They all have cholorophyll

Explanation:

Or we can say they carry out photodynthesis and make food.

See, all the pictures are green, this green pigment (colour ) is cholorophyll.

The first, second and fourth are pictures of leaves [which makes food] and the third picture is a illustration of the mitochondria.

Hope it helps!

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a common use for public land?
    12·2 answers
  • A Punnett square shows you all the ways in which ____ can combine.
    6·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The Moon is 240,000 miles away from the Earth. What prediction can
    5·2 answers
  • Two chromosomes that are similar but not identical are called _______________________. When the chromosomes are duplicated, two
    8·1 answer
  • Does anyone understand this? Help!
    8·2 answers
  • Which set of sex chromosomes do females have
    7·2 answers
  • Use the key below to report the phenotypes from the provided genotypes.
    13·1 answer
  • Answer question in pictures please!(giving brainliest)
    8·2 answers
  • During glacial maxima, australia, new guinea, and tasmania were a single land mass called?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!