1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
13

What does it mean that a hypothesis must be ‘falsifiable’ in order to be valid? A. It must have the ability to be proven wrong b

y some test. B. It must conform to experimental standards. C. It cannot be wrong, or the experiment would be pointless. D. It must be wrong the first time, or you did not learn anything.
Biology
1 answer:
vaieri [72.5K]3 years ago
7 0

Answer:

d ahg

Explanation:

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
give This question a shot and I’ll give you brainliest no links posted on My question or I will report you
Natasha_Volkova [10]

Answer:

B) 113

Explanation:

3 0
3 years ago
Read 2 more answers
What Occurs when the agents of erosion (water, wind, ice, gravity) slow down
bulgar [2K]

Answer:

then landscape would rarely happens and the there will be a lot of rocks  smooth surface

Explanation:i really don't know

3 0
3 years ago
Which statement is true about gold and helium?
nlexa [21]

Answer:

The answer is B

4 0
3 years ago
Fine sediment <br> a) deflation<br> b) loess<br> c) sand dunes<br> d ) deposition
Galina-37 [17]
Fine sediment deposited by wind is B) loess

Hope this was helpful
6 0
3 years ago
Other questions:
  • Explain the units and how to solve the following metric conversion the inside of the metric conversion by filling in the blank.
    13·1 answer
  • In both cellular respiration and photosynthesis, a(n)_________ built into a membrane pumps H+ across the membrane as electrons a
    14·1 answer
  • Instead of thinking of the cell like a school, what else can you compare a cell to? Explain your reasoning.
    7·1 answer
  • How can i run for Club President if half of the people hate me?
    10·1 answer
  • the enzyme catalase will break down hydrogen peroxide into oxygen and water. why doesn't catalase work on protein?please Be spec
    10·1 answer
  • By studying fossils, scientists have learned that A. neither animals nor plants have changed over time. B. animals have changed
    12·2 answers
  • The physical expression of the actual genetic material an organism possess is known as its:
    6·1 answer
  • How does ducks make their nests ?
    7·1 answer
  • Density is mass per Unit of volume. Which pair of lab instruments would a student use to measure the density sea water ?
    12·1 answer
  • In which situation would hydroponics be most useful for sustainable farming?(1 point)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!