1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
6

The neural signals that result from the processing of visual input in the retina converge on the _______ cells.

Biology
2 answers:
tankabanditka [31]3 years ago
8 0
The neural signals that result from the processing of visual input in the retina converge on the ganglion cells.
dexar [7]3 years ago
4 0
Hi these neutral signals that result from this is called ganglion cells.
Hope this helps please hit the thank you button and brainliest to help me.
You might be interested in
Which best describes the reactants and products of photosynthesis?
Step2247 [10]

Answer:

THE ANSWER IS (Reactants are formed inside the plant, and products are taken in from the environment by the plant. Reactants are taken in from the environment by the plant, and products are formed inside the plant.)

HEY, JOIN ME IN ZOOM PLZ I AM BORED

MEETING NUMBER IS 428-303-6421

MEETING PASSWORD IS NVA37n

Explanation:

8 0
3 years ago
Read 2 more answers
Imagen a disease that kill 50% of cockroaches in population. will this affect birth rate?
Harman [31]
Yes because more of them are gone
5 0
3 years ago
Critically analyze the following three popular training systems: bigger, faster, stronger (BFS); crossfit; and high intensity tr
elixir [45]

Answer:

The answer is explained below

Explanation:

The BFS program consists of training for agility, flexibility and sport-definite technique five days per week and weight training three days per week. This program is specifically for athletes and not for your average fitness clients; it still does not adhere to the Principle of Individual Differences.

CrossFit- Crossfit is a strength and conditioning program mainly the mix of aerobic exercise, calisthenics (Body weight exercise). In this type of gyms use equipment for multiple disciplines including barbells, dumbbell, pull-up bars. This type of workout makes body more flexible and capable to bear the abnormalities when necessary. Many types of workout are in it like, Chipper (squats, press ups, burpees), Ladder.

HIT – High Intensity Training refers to the one set failure type training program promoted as the most effective and scientifically based strength training program. In this type of program multiple sets of each exercise are performed. Volume is the most common form of weight training program seen in the gym and fitness centers. HIT also recommended sporting persons.

Human born with different strengths and weakness, this fact is considerable for the training program. When beginners at any sport see great improvement when he or she starting their programs. Person needs to improve their loading as possible to make them stronger.

Nowadays CrossFit is the best workouts to have to do because it makes physically stronger, flexible and smarter.

6 0
4 years ago
Please help! I need this very soon! Thank you so much!
Romashka [77]

Answer: good luck

Explanation:

4 0
4 years ago
Please help me on this its due in class
nikklg [1K]

Answer:

Pros:

  • You can get more scientific knowledge of the mammoth
  • You will be able to clone the mammoth easier
  • Helping the environment
  • It will help protect species that are close to extinction
  • (can't think of anything else, sorry )

Cons:

  • Different environment
  • Could go wrong and become an alien
  • Could carry retroviruses which can harm humans
  • Might CHANGE the environment for the worse
  • It might cause more species to go extinct

7 0
3 years ago
Other questions:
  • Distinguish between a tenant farmer and a sharecropper. whose exposure to risk is greater and why
    12·1 answer
  • Many plants will grow from cuttings. The cutting develops a new root system and becomes a clone of the parent plant, but an inde
    8·2 answers
  • Question 5 of 10
    9·2 answers
  • Where is the cerebellum located?
    6·1 answer
  • Cells that have a high energy requirement generally have many
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • A feature that is not the direct result of glaciation is an
    13·1 answer
  • Explain why Inuit Eskimos, despite living in polar regions with little sunlight, remain
    10·1 answer
  • In which place would you find the fewest organisms? a. the peak of Mt. Everest b.a rain forest c.a savannah d. the Sahara Desert
    8·2 answers
  • What are the main differences between the two ecosystems in terms of organism population?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!