1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
3 years ago
6

Indicate whether the given structure is located in the outer, middle, or inner ear. pharngotympanic tube helicotrema stapedius

Biology
1 answer:
Hunter-Best [27]3 years ago
4 0

Answer:

  • The p<u>harngotympanic tube </u>is in the <u>middle ear</u>.
  • The<u> helicotrema</u> is in the <u>inner ear.</u>
  • The <u>stapedius</u> is in the <u>middle ear</u>.

Explanation:

The ear has three main parts, the outer part, the middle part, and the inner part. The outer part of the ear starts in the auricle, then it continues with the auditory canal, and it finishes with the eardrum. Then we have the middle ear that is separated from the outer one with the eardrum. In this section, it is the pharngotympanic tube, also known as the Eustachian tube. It is a tube that connects the inner ear with the pharynx to regulate internal pressure.

The inner ear has the bony labyrinth and the membranous labyrinth. In this part of the ear, the mechanical signals are transformed into electrical signals. The bony labyrinth has the cochlea, the vestibule, and the semicircular canals. The helicotrema is in the cochlea, and it connects the tympanic duct with the vestibular duct.

The stapedius is a muscle located in the middle ear. Its insertion is in the stapes, a small bone that moves with the vibrations that come from the eardrum to the malleus and the stapes. The stapedius' function is to protect our hearing by reducing the vibrations that enter this part of the ear.

You might be interested in
Biologists use their observations on a small island to construct the food web shown. Their calculations indicate that the produc
Lelechka [254]

The flow of energy from one level to another does not happen with 100% efficiency. The producers only transfer 10% of the energy they absorb from the Sun. The major chunk of the absorbed energy goes into the growth of the producers, the rest gets lost in the form of waste (shedding of leaves, reproduction, etc.) and the remaining 10% is the amount that is available to the primary consumers. So by this logic, if there is 150,000 KJ of energy available at the producer level, then, only 15,000 KJ of energy will get transferred to the primary consumers.

3 0
2 years ago
Can anybody help me with this???
tangare [24]

Answer:

B

Explanation:

BBBBBBBBBBBBBB BBBBBBBBBBBB THE ANSWER I THINK IS B

3 0
2 years ago
What plant tissue located at the tips of roots and shoots will differentiate into different plant cells?
vladimir2022 [97]

Answer:

meristems

Explanation:

8 0
3 years ago
Read 2 more answers
Assume that for a given gene a mutation creates an allele that functions as a dominant negative. The gene codes for a protein th
OlgaM077 [116]

Answer: 100%

Explanation:

if the mutation presents autosomal dominant inheritance, each affected individual will show 100% alteration in the protein, thus , being dominant, it is considered that the disease pattern will predominate even if it has genes that do not express it since these will be recessive and canceled by the dominant ones.

3 0
3 years ago
Explain metabolism as attribute of Living Organism​
MAVERICK [17]

Answer:

Metabolism involves exchanges of chemical matter with the external environment and extensive transformations of organic matter within the cells of a living organism. Metabolism generally involves the release or use of chemical energy. Nonliving things do not display metabolism.

Explanation:

Brainleast please

5 0
2 years ago
Other questions:
  • In psychology, the term nature refers to traits that are a result of ___.
    7·1 answer
  • When George was younger, he had experienced a very painful tooth extraction. Because he developed an extreme fear of dentists, h
    15·1 answer
  • Muscles help to move different parts of our body. The part that moves
    15·1 answer
  • The average annual rainfall for Boston is 43.76 inches. One year, a weather station measured the city’s actual rainfall to be 33
    8·2 answers
  • Pepsi Vinegar Orange Juice What property do all three of these common household substances have in common? A) They are all acidi
    10·1 answer
  • Could you pleaseeee answer question 1 and 2 ASAPPP
    9·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which animal is a great hunter? Why?
    15·2 answers
  • Development of Male Gametophyte.
    9·1 answer
  • The formations at x and y were most likely created by
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!