1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Amanda [17]
3 years ago
6

What is the endocrine portion of the pancreas called?

Biology
1 answer:
Svetllana [295]3 years ago
8 0
The endocrine portion of the pancreas is made of small bundles of cells called islets of Langerhans. 
You might be interested in
The Venn diagram details some of the helpful and harmful effects of bacteria. In what ways are viruses like bacteria?
olchik [2.2K]

Answer:

Bacteria are unique microorganisms that have a variety of physiological functions which are beneficial to human beings. However, bacteria can also be harmful and cause infections if translocated from the gastrointestinal tract to the epithelial tissue following surgery.

3 0
3 years ago
Read 2 more answers
What is a genotype?<br><br> A , B , C, Or D
Aleksandr [31]

C. An organism's combination of genes for a trait

6 0
3 years ago
Which forms of energy need a medium to travel through?
motikmotik
Friction and earth quakes
3 0
4 years ago
Read 2 more answers
1. A ________ is a push or a pull. A. acceleration
kicyunya [14]

Answer:

1. B

2.B

3. C

4. B

5. C

Explanation:

4 0
3 years ago
During which phase of the moon do neap tides occur? full gibbous new quarter
ahrayia [7]

Answer:

The answer would be D my friend.

Explanation:

Hope this helps. Good luck and have a great day!!

4 0
3 years ago
Other questions:
  • Explain why a mark on a blade of grass will move away from the ground as the grass blade grows, but a similar mark on a tree tru
    12·2 answers
  • A deep sense of well-being results when our need for relatedness is satisfied in balance with our psychological needs for compet
    12·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Which class of amino acids contains side chains that would be unable to form hydrogen bonds with water?
    8·1 answer
  • If a food product contained fatty acids and glycerol molecules but no triglycerides, could it be advertised as fat free? Explain
    14·1 answer
  • GM (genetically modified) crops and foods: A. may have higher nutritional value than the original product. B. may be resistant t
    13·1 answer
  • Which cells make antibodies<br> a-viruses<br> b-t cells<br> c-bacteria<br> d-b cells
    6·1 answer
  • Which of the following will increase plant growth?
    15·2 answers
  • Types of stimuli the sensory organs receive.
    8·2 answers
  • Genetics problems can be solved by using logical steps.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!