1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Colt1911 [192]
3 years ago
5

What is oil of vitriol called

Biology
2 answers:
GrogVix [38]3 years ago
6 0
Oil of vitriol is called sulfuric acid
finlep [7]3 years ago
4 0
Oil of vitriol is another name for sulfuric acid
You might be interested in
How does human activity affect earths freash water resources
Nikolay [14]

Answer:

People throw their trash and pollution into the fresh water and make it not as fresh or safe to the animals as much as it could be.

Explanation:

3 0
4 years ago
PLEASE ANSWER !
Gelneren [198K]

Answer:

The pressure of a gas increases in a closed container if the volume of the gas decreases. Pressure and volume have inverse relationship which means if one increases the other decreases and vice versa. If pressure increases, volume of a gas decreases because there are a lot of empty spaces present between gas particles which are filled when gas particles come closer to each other due to pressure applied.

6 0
3 years ago
Answer the questions based on the information given.
shusha [124]

What is the rate of motion of the Amur plate? Express your answer in .  

✔ 5 mm/year

Where would the plate be after 1 million years? Express your answer in m.  

✔ 5,000 meters east

What geologic feature will form between the Amur and Eurasian plates?  

✔ new ocean floor

3 0
3 years ago
Read 2 more answers
Which of the following would NOT increase (whole body) oxygen consumption during recovery from exercise and increase excess post
Harrizon [31]

Answer:

(B) None of the answers are true...

Explanation:

(A) is wrong because the high levels of epinephrine promote activation of sympathetic nervous system that'll ultimately increase oxygen consumption.

(C) Elevated temperatures of body require immediate cooling that's why breathing rate gets high and ultimately the oxygen consumption.

(D) We all know that a vigorous dose of exercise always increases your bodies oxygen consumption.

3 0
3 years ago
The eardrum is also called
Verdich [7]

Answer: tympanic membrane

7 0
3 years ago
Read 2 more answers
Other questions:
  • Choose the correct answers from the drop-down menus.
    9·2 answers
  • Describe factors that have played a role in how humans have altered the environment.
    14·1 answer
  • Suppose that a patient is diagnosed with a new disease caused by the buildup of waste material in the body’s cells. Which organe
    15·2 answers
  • Bile is formed by
    11·2 answers
  • What's the difference between Savanna and biomes
    7·1 answer
  • Why is type o rh-negative the universal donor?
    5·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Lease do it correctly!
    15·1 answer
  • What is the central nervous system compared to
    9·1 answer
  • Respiratory pigment​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!