1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
11

What makes angiosperm more advance than gymnosperm​

Biology
2 answers:
USPshnik [31]3 years ago
7 0

Answer& Explanation:

Angiosperm is more advanced due to the mechanism of protection it has since developed as opposed to its predecessor, gymnosperm. Angiosperms could be deemed the inventors of animal-mediated pollination or dispersal, whereas gymnosperms mostly depend on wind-mediated pollination (which is far more of a gamble than animal mediated).

1) Angiosperms seeds are enclosed in fruits, which increases the chances of dispersal by either wind, water, or animals. Animals can eat the fruit and disperse the seeds via feces or by brushing the fruit off of their fur coats new areas of the terrain.

2)The development of flowers. Flowers are especially important because depending on the flower it can attract a set species of animals in order for pollination to occur. That species of animal could only focus on those few flowers and would allow the female part of the flower to receive pollen (produced by the male part of the flower) from all over the place. This theory is also applicable to animal mediated fruit dispersal.

satela [25.4K]3 years ago
4 0
Flowering plants mature more quickly than gymnosperms, and produce greater numbers of seeds. The woody tissues of angiosperms are also more complex and specialized. Their seeds are enclosed in a fruit for easy dispersal by wind, water, or animals.
You might be interested in
What are the lines of evidence that Alfred Wegener used to support the idea of continental drift? Why did scientists of his day
Zanzabum

Answer:

Wegener presented a number of evidence to prove his plate tectonic theory, such as :

  • The matching of rocks on each side of the Atlantic Ocean like a puzzle.
  • His knowledge hat organisms such as freshwater reptiles were found in almost all continents
  • He also identified organisms that live in different continents, and could not possibly cross over to the other continents due to water bodies (oceans) separating the continents.

Wegener's plate tectonic theory caused doubts to other scientists, because of the way he presented his evidence. Other scientists considered his mechanisms unrealistic

Explanation:

3 0
3 years ago
What type of molecule is represented by the model below?
bonufazy [111]
Carbohydrate is remodel
3 0
3 years ago
Read 2 more answers
Diagnose: Mrs. Harris is a 60 year old white woman. She has noticed in recent years that her height has slightly decreased. Rece
Brut [27]

<u>Answer:</u>

Q: Which skeletal system <u>disorder</u> might she be suffering from?

A: <u>Osteoporosis</u>

Q: What <u>techniques</u> could be used to diagnose her condition?

A: <u>Bone mineral density (BMD) test</u> or <u>dual energy X-ray absorptiometry (DXA) scan</u>

Q: What treatments are available?

A: Medication, healthy food.

<u>Explanation:</u>

<u>The vertebral discs between vertebrae could shrink with age</u>. Therefore, a height loss up to 1-inch is normal. However, if the height loss is more then it is possibly due to <u>osteoporosis</u>.

A <u>bone mineral density test</u>, also known as <u>dual energy X-ray absorptiometry</u> scan, is a well-adapted test to measure the amount of calcium and other minerals in the bones. It uses <u>X-rays</u> to measure the content of calcium and thus strength of bones.

A person who is already suffering from osteoporosis should be treated with <u>medicine</u> right away so that it <u>stops</u> further <u>deterioration of the bones</u> and <u>avoid any future bone fractures</u>. Further, it can be handled by <u>eating a healthy diet</u> and <u>supplements</u> such as <u>vitamins D</u>. In case some of the bones/vertebrae are <u>already fractured</u>, <u>surgical approaches</u> might be necessary.

8 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
The following explains information about antioxidants but one, which one is incorrect?
Liono4ka [1.6K]

Answer:

If you did some reaseach the answer would be c.

Explanation:

c. The foods with antioxidants are: all berries are great (strawberries, blackberries, blueberries, etc.), green leafy vegetables, carrots, tomatoes, dark chocolate, nuts, kidney beans and all beans, all herbs and foods mother nature provides us.

7 0
3 years ago
Other questions:
  • When we imagine a person exhibiting anatomical position, the palms of the hands are assumed to be facing ________.
    7·1 answer
  • Which molecule is produced by adding two electrons and one proton to NADP+?
    6·2 answers
  • Why do you sometimes shiver when your cold?
    7·1 answer
  • Which of the following happens during cell division?
    10·2 answers
  • The pH of water is a measure of its a. saltiness. b. acidity. c. color. d. cloudiness.
    7·1 answer
  • Snow geese:______________________________.
    14·1 answer
  • Which of the following cells would not divide using mitosis?
    11·2 answers
  • Seeds (dominant) and wrinkled seeds (recessive)
    8·1 answer
  • Currently, there are no known risks in genetically modifying crop species. TRUE FALSE
    10·1 answer
  • Create a list of 5 potential jobs that students of oncology can obtain.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!