Answer:
Wegener presented a number of evidence to prove his plate tectonic theory, such as :
- The matching of rocks on each side of the Atlantic Ocean like a puzzle.
- His knowledge hat organisms such as freshwater reptiles were found in almost all continents
- He also identified organisms that live in different continents, and could not possibly cross over to the other continents due to water bodies (oceans) separating the continents.
Wegener's plate tectonic theory caused doubts to other scientists, because of the way he presented his evidence. Other scientists considered his mechanisms unrealistic
Explanation:
<u>Answer:</u>
Q: Which skeletal system <u>disorder</u> might she be suffering from?
A: <u>Osteoporosis</u>
Q: What <u>techniques</u> could be used to diagnose her condition?
A: <u>Bone mineral density (BMD) test</u> or <u>dual energy X-ray absorptiometry (DXA) scan</u>
Q: What treatments are available?
A: Medication, healthy food.
<u>Explanation:</u>
<u>The vertebral discs between vertebrae could shrink with age</u>. Therefore, a height loss up to 1-inch is normal. However, if the height loss is more then it is possibly due to <u>osteoporosis</u>.
A <u>bone mineral density test</u>, also known as <u>dual energy X-ray absorptiometry</u> scan, is a well-adapted test to measure the amount of calcium and other minerals in the bones. It uses <u>X-rays</u> to measure the content of calcium and thus strength of bones.
A person who is already suffering from osteoporosis should be treated with <u>medicine</u> right away so that it <u>stops</u> further <u>deterioration of the bones</u> and <u>avoid any future bone fractures</u>. Further, it can be handled by <u>eating a healthy diet</u> and <u>supplements</u> such as <u>vitamins D</u>. In case some of the bones/vertebrae are <u>already fractured</u>, <u>surgical approaches</u> might be necessary.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
If you did some reaseach the answer would be c.
Explanation:
c. The foods with antioxidants are: all berries are great (strawberries, blackberries, blueberries, etc.), green leafy vegetables, carrots, tomatoes, dark chocolate, nuts, kidney beans and all beans, all herbs and foods mother nature provides us.