1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentina_108 [34]
3 years ago
13

Helppppoop 5th grade work

Biology
2 answers:
raketka [301]3 years ago
7 0

\frac{1}{10} Of 3,000 is 300

I got this by multiplying 300 by 10 which is 3,000

Hope this helps

-AaronWiseIsBae

Leokris [45]3 years ago
4 0

i believe the answer is 300. ;)

You might be interested in
Explain nitrogen cycle step by step in less then 5 pages
Vlad1618 [11]

Answer:

Nitrogen fixation (N2 to NH3/ NH4+ or NO3-)

Nitrification (NH3 to NO3-)

Assimilation (Incorporation of NH3 and NO3- into biological tissues)

Ammonification (organic nitrogen compounds to NH3)

Denitrification(NO3- to N2)

Explanation:

3 0
2 years ago
During dna replication, the two strands separate as the ____________ bonds connecting the parent strands are broken by an enzyme
Setler79 [48]
During DNA replication, the two strands separate as the hydrogen bonds connecting the parent strands are broken by an enzyme called helicase. In the DNA molecule (double strand) complementary bases are joined by hydrogen bonds; that is; Adenine paired to thyamine and guanine to cytosine; during replication the enzyme helicase separates the double helix by breaking the hydrogen bonds between the complementary bases. 
3 0
3 years ago
Nutrients perform three major functions in the human body. among these is (are):
Firdavs [7]
Regulate body functions, promote growth, And repair tissue
8 0
3 years ago
Read this excerpt from a persuasive essay about animal testing. Which two sentences form a hook to draw the reader’s attention?
trapecia [35]

Answer:

  • In claustrophobic laboratory a dog is forced to breathe tobacco smoke.
  • In another lab, a rat is squeezed into a narrow glass tube and forced to breathe in tobacco smoke.

Both of these sentences hook to draw the reader's attention.

These are such cruel acts done by scientists, action shall be taken against such insane work. Tobacco is so damaging to humans, then just imagine its consequences on these poor animals. Bioethics rules shall be kept in mind before doing such cruel acts.

7 0
3 years ago
How much daily physical activity do experts recommend for someone who is trying to maintain weight loss? 15 or more minutes 30 o
Advocard [28]
Hey You!

The Correct Answer Is:

Experts recommend 60 or more minutes of daily physical activity to those who are trying to maintain weight loss.

That's Your Answer! ^^
4 0
3 years ago
Other questions:
  • Based on your knowledge of how different plant groups have evolved arborescent (treelike) forms, which of the pairs of plant gro
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which is true for both photosynthesis and cellular respiration?
    13·1 answer
  • What are two jobs of the cell membrane?
    14·1 answer
  • I need help with the mRNA to the Amino Acid part...
    12·1 answer
  • Which of the following is considered assimilation in the carbon cycle?
    7·1 answer
  • What element is found in proteins,but not found in carbonhydrates
    12·1 answer
  • Help me with the last ones pleaseee:(
    12·1 answer
  • What fuels we get energy from by burning them.
    14·2 answers
  • While walking to the kitchen in the middle of the night, jamal tripped over an object that he could not see in the dark. which p
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!