1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
7

A multiparous client 48 hours postpartum who is breast-feeding tells the nurse, "i am having a lot of cramping. this did not hap

pen when i nursed my first baby." which would be the nurse's best response?
Biology
1 answer:
KengaRu [80]3 years ago
3 0

The nurse’s best response to a multiparous client why she is having cramps when it did not happen to her before will be: “For the moms who gave birth the first-time, cramping is usually mild or never felt at all. But after giving birth to your second (or third) child, you may experience more intense cramps especially while breastfeeding. The cramps are menstrual-like cramps that happen in the uterus. The uterus is a muscle, and every pregnancy stretches the muscle more giving pain and discomfort for 2- 3 days because the uterus contracts. Breastfeeding stimulates the uterus to contract.”  

You might be interested in
Cohort effects and period effects are shared by _____ cohorts.
crimeas [40]

It is shared by birth cohorts.  It is used in social science to defined variations in the characteristics of an area of study such as the incidence of a characteristic or the age at onset, such as year of birth, or year of exposure to radiation, ,  over time among individuals who are defined by some shared brain experience or common life experience. 

6 0
3 years ago
AlaskaFishing
allsm [11]

Answer:

75%

Explanation:

3/4 of the phenotype will have O blood group, and 1/4 will have A blood group.

7 0
2 years ago
Suppose an exponentially growing culture of bacteria is treated with a potential antimicrobial compound. Over the next few hours
Marta_Voda [28]

Answer:

Bacteriostatic

Explanation:

The antibiotics are the compounds which are used to treat the bacteria and are of two types: the bacteriostatic and bactericidal.

The bacteriostatic antibiotics are the antibiotics that do not kill the cells but they stop the reproduction of the bacteria and keep them in their stationary phase.

In the given question, since the antibiotic does not kill the cell but stops the doubling that is reproduction therefore the antibiotic is bacteriostatic.

Thus, bacteriostatic is correct.

7 0
3 years ago
What do scientists assume a thin ring indicates when analyzing tree rings?
Anarel [89]

Answer:

A. a year that was cool or dry

Explanation:

3 0
1 year ago
In minnesota's north woods, moving tree species to entirely new ranges where they do not currently grow, based on the notion tha
Fed [463]
<span>facilitation. This simply means that due to the Earths atmospheric changes, the trees are not likely to be able to spread as they naturally would, facilitation is simply helping that process along so that it occurs as it should.</span>
4 0
3 years ago
Other questions:
  • Why are only inherited traits, not acquired for the process of natural selection
    15·1 answer
  • How does leap year work?
    12·1 answer
  • Which statement describes the current theory about the relationship between the human population and mass extinction? The human
    15·2 answers
  • Match each organism with the correct description.
    14·2 answers
  • Why are so many eggs produced by invertebrates?
    7·1 answer
  • Directions
    7·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Please help me. I been stuck on this question for a long time :(​
    10·1 answer
  • I'LL GIVE BRAINLIEST: Which sentence best explains how a unicellular organism gets nutrients? Explain why.
    14·1 answer
  • 1. Look at this image and state the biotic and abiotic factors:​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!