4 years ago

How do natural disasters weaken a community's social infrastructure?

2 answers:

5 0

Systems are unbalanced by the damage caused by natural disasters. Natural disasters tend to target the poorest members of a community. Natural disasters can cause billions of dollars in property damage.

uranmaximum [27]4 years ago

3 0

By damaging transportation, communication, and everyday schedules. These are a few ways that natural disaster might weaken a public area. Lives taken might slow workers and progressiveness due to mood swings and depression. Jobs also become rarer because of raw destruction.
I hope this helps! :)

You might be interested in

Leto [7]

1. Sustainable 2. Environmental

3 0

4 years ago

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0

3 years ago

In terms of energy, what kind of system is earth

shusha [124]

The answer is both open and close but it can only be one so i would go with d. open

5 0

4 years ago

Read 2 more answers

There are two continents with an ocean between them. Today, the continents have very different plants and animals on them. Howev

kvasek [131]

Answer:

The continents could have gotten so far because of plate tectonic movement. We know that the plates are always moving so if these plates were very active then it would have caused supercontinent pangea to drift apart. This process must have taken more than a million years to happen.

Explanation:

6 0

3 years ago

A patient receives prochlorperazine by im injection. the nurse would expect the drug to begin acting within which time frame?

KonstantinChe [14]

Hey there,
The answer is 10 - 20 minutes.

Hope this helps :))

<em>~Top♥</em>

6 0

4 years ago