1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikitadnepr [17]
3 years ago
6

Proteins that are involved in packaging the eukaryotic chromosome into "beads" called __________ are __________.

Biology
1 answer:
Brilliant_brown [7]3 years ago
5 0
<span>Proteins that are involved in the packaging of eukaryotic chromosome into "beads" called nucleosome are histones.</span>

 A nucleosome is a segment of DNA wound in sequence around eight proteins called histones. Together the DNA and the histones form  "beads"
A nucleosome is the basic unit of DNA packaging in eukaryotic cells.



You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Which leaf is most likely from a gymnosperm?<br> W<br> X<br> Y<br> Z
pogonyaev
Y i think is the asnwer
4 0
3 years ago
Read 2 more answers
A single species that has evolved into several different forms that live in different ways has undergone a. adaptive radiation b
wlad13 [49]
A single species that has evolved into several different forms that live in different ways has undergone "b. convergent evolution" since the multiple "divergent" species are seen to "converge" into a single species if you go back far enough in time. 
8 0
3 years ago
Read 2 more answers
- WORD BANK
stiv31 [10]
B cytoplasm passes light threw the eye
7 0
2 years ago
Suppose a mother carries two recessive genes for freckles (rr) and a father carries one recessive gene for freckles and one domi
skad [1K]
Answer - A
The ratio of a child with clear skin with that of freckled skin is 1:2.
When genotype rr mates with genotype Rr, the following genotypes are expected:
Rr = clear skin dominant
rr= freckled skin

8 0
2 years ago
Other questions:
  • A nurse is promoting routine papanicolaou tests to young adult women at a community based preventative care health fair. a pap t
    12·1 answer
  • What are 2 suffixes that the scientific sugar names end with?
    12·1 answer
  • Drosophila eye color is an X-linked trait. Red eye color is dominant, and white eye color is recessive. Which Punnett square sho
    7·2 answers
  • Which of the following statements is true?
    13·1 answer
  • Where did Darius build a new capital?
    10·1 answer
  • Give an example of potential and kinetic energy in a living organism.
    5·1 answer
  • How do plants grow helppp
    14·2 answers
  • HELP PLS FOR A REAL ONE
    13·1 answer
  • ***I WILL GIVE BRAINLIST*** What determines the order in which new nitrogen bases line up?
    5·1 answer
  • I am a table true or false
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!