1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexandra [31]
3 years ago
8

Bacteria are grown in 15N (heavy) medium and then transferred to 14N (light) medium and are allowed to replicate for 1 generatio

n. The DNA is subsequently isolated and centrifuged in a CsCl2 gradient to yield what type of gradient band(s)?
Biology
1 answer:
ahrayia [7]3 years ago
4 0

Answer:

The intermediate density band is observed.

Explanation:

Messelson and Sthal's explained the model of  semi conservative nature of DNA replication. According to this model, the newly synthesized DNA molecule contains one newly synthesized strand and one parental strand.

Firstly, bacteria grown in 15N media is transferred to 14N media. The isolated DNA is centrifuged and intermediate density DNA  band is observed that contains one strand of 15N (parental strand) and one strand of 14N (newly synthesized strand).

You might be interested in
The diagram shows the first part of a kidney tubule and its blood supply. During filtration, protein molecules do not pass throu
Yakvenalex [24]

During filtration, the highest concentration of protein are generally found in the glomerulus capillary, which is labeled as B.

<h3>What is a kidney?</h3>

A kidney refers to a pair of bean-shaped organ within the body of an organism which is typically responsible for the excretion of excess fluids as wastes. Also, the kidney is an organ that helps to filter blood and produce urine in vertebrates.

During filtration, the highest concentration of protein are generally found in the glomerulus capillary, which is labeled as B in the diagram shown in the image attached below.

Read more on kidney here: brainly.com/question/15490784

#SPJ1

6 0
2 years ago
The lungs, nose, and trachea are organs of the respiratory system. Which best describes these organs? A) They deliver nutrients
Romashka-Z-Leto [24]
B.) they deliver oxygen to the blood
5 0
3 years ago
Read 3 more answers
Which of these is a type of organic matter found in plants?
Nadya [2.5K]

Answer:

Oxygen

Explanation:

6 0
3 years ago
Match the food item to its nutrient group
ss7ja [257]

Macronutrients can be defined as the compounds which can be found in large quantities in the human diet. Majority of the energy for the functioning of the body is derived from these macronutrients. These includes the fats, carbohydrates, and the proteins.

Micronutrients can be defined as the compounds which are required by the body in small quantities, but they are essential for the proper growth of the body. These includes the vitamins and minerals.

Hence, the given food and the nutrient groups can be matched as follows:

Macronutrients - Carbohydrates, proteins, fats.

Micronutrients - Zinc, calcium.

4 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • "what is the most difficult step in reconciling a checking account"
    7·2 answers
  • What would happen to this landscape feature if the climate became more humid
    14·2 answers
  • 15points+brainliest to whoever answers right!! please help it’s due tonight :(!
    13·1 answer
  • The balanced equation for photosynthesis is shown below. 6 CO2 + 6 H2O → C6H12O6 + 6 O2 What best explains whether mass is conse
    12·2 answers
  • Sara measured the amount of potassium nitrate (KNO3) that could be dissolved in 100 grams of water at different temperatures. Sh
    6·2 answers
  • I got points just for you IF you answer this question
    8·1 answer
  • Explain what happens to engery through a system ​
    15·1 answer
  • What happens when two organisms attempt to occupy the same niche?
    15·1 answer
  • Can somebody help me on this
    7·1 answer
  • 3.<br> How does the sperm differ structurally from the egg?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!