Answer:
DNA carries the genetic information for making proteins. ... The base sequence determines amino acid sequence in protein. Messenger RNA (mRNA) is a molecule which carries a copy of the code from the DNA, in the nucleus, to a ribosome, where the protein is assembled from amino acids.
Explanation:
(meow) <3
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
You already answered the question in the picture above
I don’t think it would change the effectiveness , if bees got used to it or it had always been like that, they wouldn’t have a problem, but if it was a sudden change then they might dislike it
