1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miv72 [106K]
3 years ago
9

Signs and symptoms that a woman should report immediately to her health care p rovider include:________.

Biology
1 answer:
solong [7]3 years ago
6 0

The question is incorrect.

the correct question is Signs and symptoms that a prenant woman should report immediately to her health care provider include:________.

a. vaginal bleeding

b. rupture of membranes

c. heartburn with severe headache

d. decreased libido

e. urinary frequency

Answer:

a. vaginal bleeding

b. rupture of membranes

c. heartburn with severe headache

Explanation:

A pregnant woman should report immediately about vaginal bleeding

, rupture of membranes

, and heartburn with severe headache to her health care provider.

<u>A) Vaginal bleeding: </u>vaginal bleeding is uterine bleeding, which is common in the earlier stage of pregnancy but if it is continous it can be symptoms of miscarriage, so one should immediately contact her healthcare provider.

<u>B) Rupture of membranes:</u> If any pregnant women experience rupture of membrane, it causes steady leakage of fluid from the vagina. If the rupture is preature it can cause some complications in the baby such as premature birth, infection, and cord compression.

<u>C) Heartburn with severe headache:</u> if a woman experiences heartburn with severe headache during pregnancy, she should immediately contact her healthcare provider as it can be symptoms of preeclampsia (condition develops during the second half of pregnancy).

Hence, the correct options are a) vaginal bleeding

, b) rupture of membranes

, and c) heartburn with severe headache

You might be interested in
Which phase of Mitosis is pictured?
Sveta_85 [38]
OOO IM SMART ITS PROPHASE
7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
When ATP loses a phosphate, energy is released ________ and is formed.<br> What is the blank??
Alexus [3.1K]

When ATP loses a phosphate, energy is released and ADP is formed



5 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST!!!!
Archy [21]

The main difference between Exponential growth and Logistic growth is that logistic growth takes into account carrying capacity. On a graph, logistic growth levels off as it nears carrying capacity while exponential growth does not.

Exponential growth involves a positive feedback loop and Logistic growth involves a negative one.

please mark as brainliest if correct!

3 0
3 years ago
Read 2 more answers
The seminal vesicles select one:
ratelena [41]
The Answer to this question is b
6 0
3 years ago
Other questions:
  • How is information for a specific protein carried on the dna molecule
    12·1 answer
  • Mechanical weathering ____.
    10·2 answers
  • Compare the four main layers of the atmosphere
    10·2 answers
  • Explain the process of photosynthesis in a Step-by-step in detail.
    14·2 answers
  • What is a gene?
    5·2 answers
  • What bodies of water may be cold
    5·2 answers
  • Night blindness is cause by​
    15·2 answers
  • Câu 1. Tổ chức sống nào sau đây có cấp thấp nhất so với các tổ chức còn lại ?
    11·1 answer
  • Which stains are used to visualize structures in the bacterial cell wall
    8·1 answer
  • The circulatory system help to maintain homeostasis by interacting with the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!