The answer is; glycolysis
This process converts glucose molecule to pyruvate. It is an oxygen-independent pathway, unlike the Krebs cycle. Glycolysis occurs in the cell cytoplasm while the Krebs cycle (aerobic pathway) occurs in the mitochondria. In the presence of oxygen, the product of glycolysis, i.e pyruvate, is fed to the Krebs cycle. If oxygen is unavailable the pyruvate is converted to lactate.
Fat found in blood and lymphatic fluid
Answer:
Repetition first one
Accuracy third one
Precision fourth one
Replication last one
last one is the second on right second
Answer:
The movement of proteins and enzymes within a cell is facilitated by intracellular receptors.
Explanation:
Proteins and enzymes (which also are proteins) move inside the cell through intracellular receptors. These receptors are proteins capable of binding other molecules such as proteins and hormones in order to transport them to different cellular locations. Thus, intracellular receptors are key players in signaling pathways that trigger signaling events to regulate a particular function, for example, activating gene expression by transporting proteins to the nucleus.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
