All categories

2 years ago

Which process can be found in both bacteria and protists?

2 answers:

6 0

Protists obtain food in one of three ways: absorption, ingestion, and engulfing. Most protozoa are free-living in soil and water and enter the activated sludge process through inflow and infiltration. Bacteria are the primary food source for protozoa

leonid [27]2 years ago

6 0

Answer:

absorption, ingestion, and engulfing

Explanation:

hope this helps!

You might be interested in

How do consumer get matter

Trava [24]

Consumers must obtain their nutrients and energy by eating other organisms. Decomposers break down animal remains and wastes to get energy.

3 0

3 years ago

Read 2 more answers

Whats the capital of florida

V125BC [204]

Tallahassee is the capital of florida

8 0

2 years ago

Read 2 more answers

Imagine you lived in the late 1800s. How would your life be different? Identify some ways it might be better and some ways it mi

Zolol [24]

Answer:

if i lived in the 1800s I think would have more free time because i wouldn't be on electronics all the time. I might not have an education because times were hard then and many kids had to work in factories like their parents to support the family. I could get sicker easier because there weren't many health codes back then and lining conditions weren't teh best

6 0

3 years ago

Read 2 more answers

Select the correct answer.

viva [34]

Answer:

Explanation:

3 0

2 years ago

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago