1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
14

Someone please help me

Biology
1 answer:
lina2011 [118]3 years ago
7 0
Sound waves cannot travel through a vacuum. This is because sound waves move by actually compressing molecules--therefore in a vacuum it would be impossible for sound to travel. This is also why no sound can be heard in space.
You might be interested in
Explain why you know that diuron caused the coral to bleach.​​​​​​​
CaHeK987 [17]
When corals are stressed by changes in conditions such as temperature, light, or nutrients, they expel the symbiotic algae living in their tissues, causing them to turn completely white. Warmer water temperatures can result in coral bleaching. ... This is called coral bleaching. When a coral bleaches, it is not dead. So basically diuron is stressing the plants.
4 0
3 years ago
What is a karyotype? a. a system of classifying cell nuclei b. a unique combination of chromosomes found in a gamete c. the set
Sergio039 [100]

Answer:

Option (d).

Explanation:

Karyotype may be defined as the process of the determining of the chromosome complement of the individual organism. The complete set of an organism's chromosome can be determined by karyotype.

The karyotype displays the each and every pair of homologous chromosome. The chromosomes are organised according to their shape and size. The abnormal chromosome can easily be determined by the karyotype.

Thus, the correct answer is option (d).

6 0
4 years ago
How long did it take N.E.A.R. to reach Eros?
Katen [24]

Answer:

Explanation:

NEAR remained in this orbit for 10 days and then was backed out in stages to a 100 km circular orbit by September 5, 2000. Maneuvers in mid-October led to a flyby of Eros within 5.3 km of the surface at 07:00 UT on October 26.

Launch date: February 17, 1996 20:43:27 UTC; ...

Closest approach: June 27, 1997 12:56 UTC; .

8 0
3 years ago
An 88.5 g sample of an unknown solid is heated to 55.0°C and placed into a calorimeter containing 150. g of water at 23.0°C. If
OlgaM077 [116]

Answer:

Not really sure but pretty sure it's 78.8 fahrenheit.

4 0
3 years ago
Read 2 more answers
Men's bodies contain more __________ than women so they can consume slightly more alcohol to reach the same bac
AleksAgata [21]
Men's bodies contain more water than women

8 0
3 years ago
Read 2 more answers
Other questions:
  • What tool is use to measure an objects mass??
    8·1 answer
  • as the number of insect species declined due to spraying, the blueberry production decreased. Explain how these two events might
    6·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • I need help i dont understand
    13·2 answers
  • Which statement correctly compares metaphase I and metaphase II?
    9·1 answer
  • What type digestion processes happens in the mouth with the teeth?​
    13·1 answer
  • A chemical pesticide was applied to an area of this ecosystem by landowner to control the mouse population. There was decrease i
    14·1 answer
  • PLEASE HELP I WILL MARK BRAINLIEST‼️ <br> EXTRA POINTS‼️‼️‼️
    13·1 answer
  • Distinguish between:<br> Bat and Dove​
    7·2 answers
  • A relationship between two species in which both species benefit.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!