1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
7

We cannot see evaporation because water vapor is invisible. How can we tell it is happening?

Biology
1 answer:
nikdorinn [45]3 years ago
3 0
You can tell that water is evaporating by measuring how much you have left in the container

If you star an experiment with 20ml of water and a few hours later there are 17ml you know 3ml of water evaporated
You might be interested in
How does an early onset of spring through climate change affect plants?
hjlf
The answer is letter A. 

Plants that are affected by climate change tend to have a growing and flowering season that starts very early and lasts longer than normal. This certainly puts an imbalance in the ecosystem which causes many environments to have a different stake of demand and supply for food for other primary and secondary consumers. The early onset of spring affects the plant's budding time which would then escalate to early development of fruits and later on will progress to a lack of supply when the need for that food arises for other organisms.
6 0
2 years ago
Read 2 more answers
What charge does a neuron have at its resting potential?
Mariulka [41]
I think it would be Positive
8 0
3 years ago
During protein synthesis, many copies of a specific
Mama L [17]

Answer:

snsngdsnbfd

Explanation:

gbfnvddddddddddddcbcvgbngng

6 0
1 year ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
What placental hormone is responsible for prompting breast duct development and ligament flexibility during pregnancy?
grandymaker [24]

Answer:

I don't know this one sorry

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Along with the spin of the Earth, what causes its magnetic field?
    8·2 answers
  • A substance when dissolved in water increases the H= ion concentration of the solution. Which type of solution is formed?
    14·1 answer
  • When veiwing a human karyotype to detect genetic disorders, whic situation indicate a genetic problem
    13·1 answer
  • What two structures work together to change the volume of the chest during ventilation?
    10·1 answer
  • (tco 5) which mineral is needed for the proper functioning of nerves, muscles, and bones?
    10·1 answer
  • What combination of alleles best describes a sex linked trait
    14·2 answers
  • 9x7÷8-12×6............
    5·2 answers
  • explain how blood flow in the skin helps to maintain a constant body temperature in very hot conditions.
    7·1 answer
  • anyone can help me with this please??? (which bar graph could represent the reaction rates of a reversible reaction that has jus
    9·1 answer
  • Which is one way that DNA replication is similar in eukaryotic cells and prokaryotic cells?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!