1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nalin [4]
4 years ago
7

One king dumb is not named in the graphic. It contains the most ancient bacteria that live in extreme environments. Examples inc

lude: halophiles and methane gems. To which kingdom do these belong ?
A. Fungi
B. Archaea
C. Bacteria
D. Archaebacteria

Biology
2 answers:
hjlf4 years ago
5 0

Answer:

B

Explanation:

halophiles are classified into the Archaea domain, there are also bacterial halophiles and some eukaryota

Vinil7 [7]4 years ago
4 0

Answer:

Archaebacteria

Explanation:

I just did the USATestprep hope this helps

You might be interested in
When several genes influence a trait​
shutvik [7]
A “polygene” or “multiple gene inheritance” is a member of a group on non-epistatic genes that interact additively to influence a phenotypic trait.
7 0
3 years ago
Is MRSA a eukaryotic or prokaryotic structure?
Sergeeva-Olga [200]

MRSA is a prokaryotic structure

6 0
3 years ago
What is the difference between DNA and Rna
dedylja [7]
DNA is a polymer that contains deoxyribose and a phosphate backbone. It contains these 4 nitrogenous bases: Adenine, Guanine, Cytosine and Thymine. 

RNA on the other hand is a polymer that contains ribose and phosphate backbone. It contains 4 nitrogenous bases of: Adenine, Guanine, Cytosine and Uracil.

Hope that helps a bit.
6 0
3 years ago
How would you know whether it was in metaphase i and metaphase ii.
egoroff_w [7]

Metaphase 1 is associated with meiosis 1 whereas the metaphase 2 is associated with meiosis 2. The main difference between metaphase 1 and 2 is that chromosomes are attached as homologous pairs at the equator during the metaphase 1 and during metaphase 2, single chromosomes are attached at the equator

7 0
2 years ago
And son
Korolek [52]

Answer:

A and B

Explanation:

7 0
4 years ago
Other questions:
  • How does the human body benefit from having four types of tissue?
    9·1 answer
  • What have observed more than 50,000 asteroids
    6·2 answers
  • "Warehouse," stores water and food materials. Plant cells have a large one,
    11·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • The following graphs show the sizes of four different populations over a period of time. Write a sentence summarizing what each
    12·2 answers
  • For which of these is DNA ultimately responsible?
    5·1 answer
  • Mitochondria are organelles found in both plant and animal cells. These organelles are rod-shaped with cristae and highly folded
    9·1 answer
  • List the different methods of antibiotic resistance that a mutation can give a bacterium:​
    6·2 answers
  • Between which two planets is Jupiter located in our solar system?
    15·2 answers
  • In complementary base pairing of DNA, adenine pairs with ________ (or ________ in RNA) and cytosine always pairs with ________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!