1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
3 years ago
10

Nucleotides are the basic unit of what macromolecule

Biology
1 answer:
Afina-wow [57]3 years ago
5 0
DNA (deoxyribonucleic acid)
You might be interested in
Vascular plants exhibit alternation of generation. What is alternation of generation?
nasty-shy [4]
I think the answer would be A 
5 0
3 years ago
PLEASE HELP WILL GIVE BRAIN!! The small dark cylinder shaped structures that help separate the chromatids are called !!
murzikaleks [220]

Answer:

Centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

3 0
3 years ago
Read 2 more answers
Telemedicine and remote monitoring are part of a _____ _____ trend.
Nat2105 [25]
Telemedicine and remote monitoring are pat of a WORKGROUP COMPUTING trend. Telemedicine is the use of networking technology to provide medical information and services remotely. The trend toward online collaboration is called workgroup computing or collaborative computing.
7 0
3 years ago
Because nadh generated in the cytosol cannot enter the mitochondrion, electrons and protons from nadh are transferred in by ____
klio [65]
I think the correct term to fill in the blanks would be glycerol phosphate electron shuttle. This shuttle is responsible of transporting agents that are reducing into the inner membrane of the mitochondria. Since NADH cannot enter, it is reduced so that the electrons could go in to the transport chain.
5 0
3 years ago
Bagaimana adaptasi tubuh manusia terhadap kadar oksigen yang rendah dipegunungan
never [62]
<span>Persentase oksigen di udara di dua mil (3,2 km.) Pada dasarnya sama dengan di permukaan laut (21%). Namun, tekanan udara adalah 30% lebih rendah pada ketinggian yang lebih tinggi karena fakta bahwa atmosfer kurang padat - yaitu, molekul udara yang jauh apart.When kita menghirup udara di permukaan laut, tekanan atmosfer sekitar 14,7 pounds per square inch (1,04 kg. per cm.2)


(i speak indoinision to)
</span>
7 0
3 years ago
Other questions:
  • Write 1 to 2 paragraphs explaining the role chromosomes play in heredity. Include the structure and function of chromosomes.
    11·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The scientific name of a living thing is made up of its genus and _____ names.
    9·2 answers
  • Endosymbiotic theory in chronological order
    10·1 answer
  • Which molecule contributes to the greenhouse effect?
    13·1 answer
  • Which term names part of the peripheral nerves system A spinal cord B brain C sensors​
    9·2 answers
  • When is the Doppler Effect perceived by a person?
    9·1 answer
  • Outline the synthesis, storage, and release of peptide hormones. Which organelle(s) is (are) involved
    15·1 answer
  • What evidence best supports the conversation during photosynthesis?
    8·2 answers
  • What are some environmental advantages of building green? (site 1)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!