1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
3 years ago
6

Your patient has been admitted to the emergency room with an occupational injury from an industrial saw. he has lost a significa

nt volume of blood. what effect has this blood loss likely had on his blood pressure, and why
Biology
1 answer:
Montano1993 [528]3 years ago
8 0
<span>The body will lose blood pressure due to the loss of blood.The heart has to work harder causing extra stress and strain on the body.This blood loss can be very dangerous and cause a person to go into shock.</span>
You might be interested in
At which site would you be most likely to find fossil remains of australopithecus africanus?
astra-53 [7]
IN AFRICA thats where you'll find many fossils :D
5 0
3 years ago
In fungi, the 80S sedimentation coefficients are synthesized by this intracellular structure. ___________
Vladimir79 [104]

Answer:

Nucleolus

Explanation:

The nucleolus is a compact structure present in the nucleus of fungal cells and all other eukaryotic cells. The nucleolus is not enclosed by a membrane. Nucleolar organizer present in the nucleolus contains the instructions for the synthesis of ribosomal RNAs.

Ribosomal proteins are synthesized in the cytoplasm. The ribosomal proteins are transported from the cytoplasm into the nucleolus. Assembly of ribosomal proteins and ribosomal RNAs to make ribosomal subunits occur inside the nucleolus which then enters cytoplasm to carry out protein synthesis.

6 0
3 years ago
What type of rock is Sevehah Cliff made of?
Lisa [10]

Answer:

Paleozoic metasedimentary rocks

The Sevehah Cliffs are composed of early Paleozoic metasedimentary rocks of the Mt Morrison roof pendant. Prominant formations include the light-colored calcareous quartzite of the Mount Morrison formation and the darker reddish brown rocks of the Squares Tunnel formation

Explanation:

5 0
3 years ago
Which of the following is one of the primary tasks of a zoologist?
ozzi

Answer:

1st is the right

Explanation:

Mark me as a brain list

5 0
3 years ago
Type your answer here.
olga_2 [115]
Autotrophs can produce their own food. Heterotrophs rely on autotrophs for food.
6 0
3 years ago
Other questions:
  • A nurse who is working in the poison control center receives a telephone call from a parent
    15·1 answer
  • The presence of Auer rods in the cytoplasm of cells rules out _________
    8·1 answer
  • An average what takes about 5 kilograms of Carbon Dioxide a year and makes about the same amount of oxygen for us to breathe.
    13·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Describe the path of energy conversions, beginning with light energy from the sun and ending with the energy in your muscles.
    9·1 answer
  • The neurotransmitter associated with bulimia nervosa is ______________.
    14·2 answers
  • Which of the following phase changes would absorb energy as it occurs?
    12·1 answer
  • Comparing and Contrasting in which class of elements is there a greater range of properties, the metals or the nonmetals? Give a
    9·1 answer
  • How could the changes made to the amino acid sequence influence phenotype changes?​
    15·1 answer
  • Which of the following is NOT a limiting factor for animals in an ecosystem?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!