The answer is true. During translation of mRNA, the nucleotides are read by the translation unit (ribosome and trna) in sequences of three (3). These sequences are referred to as codons. Codons code for amino acids. Some codons are start of stop codons meaning they initiate or terminate translation. Additionally, more that one codon could code for one amino acid.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
I am pretty sure that the medical condition you're looking for is Intussusception.
In Unicellular-reproduce organisms while Multicellular-repairs
dead or damaged cells. They both help
develop and grow. in the multicellular
this organism is made up of 2 or more cell they can be made up to trillion if
cells, it is much more complex than the unicellular. They reproduce asexually and the cells cannot
live outside the organism, they perform specialized functions an example:
nerves.
