What is the correct response to a sewage backflow in an operation?

2 answers:

8 0

In case of food service operation, the mangers need to take an extra care to maintain the hygienic structures, for this, they must be aware of all the conditions going on in the operation.

In case, a food service operation experiences the back flow of the sewage, the operation should be immediately stopped. Sewage water is very unhealthy and the bacteria in the sewage water can cause many types of illness, which can contaminate food.

So, it is very important that all the operations should be stopped immediately, till the sewage back flow is not cured and the area is thoroughly cleaned.

hence, the correct answer is Close the operation.

posledela4 years ago

3 0

Answer:mop the entireoperstion with a sanitizing solution

Explanation:

You might be interested in

Do enzymes provide energy for chemical reactions?

timama [110]

Answer:

Enzymes are biological catalysts. Catalysts lower the activation energy for reactions. The lower the activation energy for a reaction, the faster the rate. ... The enzyme active site is the location on the enzyme surface where substrates bind, and where the chemical reaction catalyzed by the enzyme occurs.

Explanation:

7 0

3 years ago

Read 2 more answers

¿El agua es un compuesto formado por moléculas de hidrogeno y oxigeno; dicho compuesto es un tipo de enlace?

Burka [1]

Answer:

Cómo se unen los átomos en la molécula de agua? ... Los dos hidrógenos están unidos al oxígeno por enlace covalente, que es un enlace bastante fuerte y estable en el que los átomos implicados comparten pares de electrones.

8 0

3 years ago

Is a sea cucumber a producer

Dimas [21]

Sea cucumbers are consumers because they eat any organic material they find, and event sometimes the mud or sand they live in.

8 0

3 years ago

ACTIVITY 3

Gwar [14]

Answer:

mucus

trachea

hope it helps you <3

5 0

3 years ago

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

torisob [31]

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

5 0

2 years ago