1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
4 years ago
12

Societies may have different perspectives on the use of technology. Which

Biology
1 answer:
Alenkasestr [34]4 years ago
6 0

Answer:

C. Looking for ways to obtain water from the ground

Explanation:

The environment shown in the attachment above is a dry area (arid or semi-arid area), as we can see the few vegetation in the environment are very scanty and dispersed.

Water resources in such environment is scarce and difficult to obtain. Thus, people who live in such environment would be very likely to use technology to solve the problem of getting water from the ground.

<em>The most likely concern if the people in such environment would be: "C. Looking for ways to obtain water from the ground"</em>

You might be interested in
Look at the table you filled in above. How does the numbers for how much the snakes are consumed compare to how much these preda
S_A_V [24]

The number of organisms decreases on movement from producers to consumers in a food chain. This happens due to decreased energy levels at higher trophic levels.

<h3>What is a food chain?</h3>

Food chain is the sequence of matter and energy transfers as food from one organism to another.

Food chains interconnect locally into a food web as most organisms consume more than one type of animal or plant.

The number of organisms decreases on movement from producers to consumers in a food chain. This happens due to decreased energy levels at higher trophic levels.

Thus, it can be concluded that this is the main reason behind the number of snakes consumed as compared to other organisms.

For more details regarding the food chain, visit:

brainly.com/question/16065961

#SPJ1

8 0
2 years ago
Determine the proportion of offspring phenotypes that would result when two merle dogs mate, if both dogs are heterozygous (Ll)
Brut [27]

Answer:

75% would have the dominant traits for coat length, 25% would have recessive trait for coat length.

Explanation:

After completing a punnet square, we could find that our genotypes are 25% LL, 50% Ll, and 25% ll.

If these genotypes were to be physically expressed, LL and Ll would both be expressed as showing the dominant trait.

This means that 75% would have the dominant traits for coat length and 25% would have recessive trait for coat length.

I hope this was helpful! Let me know if you need any clarity.

6 0
3 years ago
Most enzymes fall into which group?
Rus_ich [418]
I am pretty much sure that C. Lyases is the answer.

Let me give some information about this.

Lyases are the main groups which show peculiarity in having more than several categorised groups having more enzymes than the other four.

Hydrolase does not fit this bill instead they contain less categorised groups.

Other two groups are not even having that much groups.

Hope helps ...
4 0
3 years ago
Read 2 more answers
What molecule is carbon dioxide used in
Andrew [12]
Carbon dioxide (chemical formula <span>CO2</span>) is a colorless and odorless gas vital to life on Earth. This naturally occurring chemical compound is composed of a carbon atom covalently double bonded to two OXYGEN ATOM
5 0
3 years ago
A fertilized egg undergoes several stages before it is successfully implanted. The
zloy xaker [14]

Answer:

it is implanted in the tissue of uterus.

Explanation:

the egg cell is usually fertilized in the oviduct and then sweeped out or moved out of the oviduct by cilia or peristaltic movements in the oviduct to the uterus. when it is moved to the uterus it is imolanted in the tissues there. give me a brainliest if i helped!♡

7 0
3 years ago
Other questions:
  • The concept that living cells only arise from preexisting living cells is called:
    14·1 answer
  • What might be an advantage of having more than one codon for the same amino acid?
    5·1 answer
  • Which of the following best describes physical weathering? A.) A series of chemical changes that wears away at rocks B.) The mov
    14·1 answer
  • To determine whether a bloodstain is of human or animal origin, the serologist will perform
    10·1 answer
  • Key Concept Check Why is Earth warmer at the equator and<br> colder at the poles?
    13·2 answers
  • Which of the following cells would not divide using mitosis
    10·1 answer
  • How does budding in yeast resemble fission in paramecium? How does it Differ?
    10·2 answers
  • Which of the following situations involves an external attribution?
    15·2 answers
  • How do cells make more ATP when they run out? <br><br> HELP PLZ
    8·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!