1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
3 years ago
12

What are the five main gyres

Biology
1 answer:
Minchanka [31]3 years ago
4 0
Indian ocean gyre
North atlantic gyre
North pacific gyre
South atlantic gyre 
south pacific gyre  

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Is anaerobic metabolism only common in elite athletes?
lyudmila [28]
<span>Yes, the elite athlete gives higher readings when compared to the non elite athletes in the anaerobic activities. Anaerobic metabolism is the process of giving energy to the athletes by burning the carbohydrates without any oxygen presence. This energy helps them to give elite performances.</span>
3 0
3 years ago
What are the two major components of the tobacco mosaic virus?
rjkz [21]
<span><span>Hi,

The two major components of the tobacco mosaic virus were:
 
1. Protein Coat/Capsid: Each rod consists of about 2130 elliptical protein subunits (capsomers). They are closely packed together and arranged in a helical fashion

</span><span>2. Nucleic Acid: It is a single-stranded RNA helix having a diameter of 80 Å.

Hope I helped :))))</span></span>
7 0
3 years ago
Identify the type of friction acting in each scenario.
serg [7]
Fluid, rolling, air resistance, and not sure about the last one.
8 0
4 years ago
Read 2 more answers
You want to determine the likely clinical course and possible complications for a sprinter who had a release for acute compartme
Ket [755]

Answer:

Ask for feeling of Numbness,, Pain,,Use of the affected limb,, Fever

Explanation:

All these tends to rule out the complications of this condition

6 0
3 years ago
Other questions:
  • You need to measure three things: 1. a quantity of water 2. the length of a leaf 3. the mass of a small stone Which unit of metr
    7·1 answer
  • The idea that light is not matter is supported by which of the following evidence?
    5·2 answers
  • What role does cellular respiration play in the water cycle
    13·2 answers
  • A DNA strand has 30% guanine. How much adenine would there be in the same strand
    15·1 answer
  • In 1963 a new island was formed from a volcanic eruption. The island was named Surtsey and is located off the southern end of Ic
    9·1 answer
  • Why did you cut out the chromosomes in pairs
    14·1 answer
  • Fungi are classified by their method of
    15·1 answer
  • How would the amount of available energy differ in the trophic level of the mouse compared to the trophic level of the hawk?
    10·1 answer
  • Which of the following was true about the experiment conducted by Miller and Urey
    10·1 answer
  • Which of the following statements about elements and atoms is true?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!