1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
2 years ago
12

While type 2 cells make to keep air sacs open.

Biology
1 answer:
choli [55]2 years ago
8 0
Pulmonary alveolus is the answer.
You might be interested in
What would be the magnification of a specimen viewed with a compound light microscope that has an objective power of 10x and an
tekilochka [14]
It could be 50x for magnification
5 0
3 years ago
Read 2 more answers
How will the stomata look with high water pressure
dalvyx [7]
The stomata of leaves are surrounded by guard cells. The guard cells help the leaves to regulate the rate of transpiration of water from the leaves by opening and closing the stomata. When water enter the guard cells, they swell and bulge and this makes the stomata to open. So, with high water pressure, the guard cells will stimulate the stomata to open. The reverse will be the case if the water pressure is low.
3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What is the expected growth mile markers for a 6-month infant?
Fofino [41]
The expected growth mark marker for a 6 month old infant is that the infant can transfer objects from hand to hand, rolls from prone to supine, sits well unsupported, presents with stranger anxiety, and that the patient can babble.

7 0
3 years ago
Solar energy is utilized to convert inorganic carbon, in the form of carbon dioxide, into organic carbon compounds, such as gluc
Lerok [7]
B) Photosynthesis The Sun is the ultimate source of all energy in the universe. Plants being the main primary producers or autotrophs, use solar energy to make their own food through photosynthesis, thus converting energy into the organic matter that can be consumed by all organisms. They  form the basis of almost all food chains from where consumers derive their food.
7 0
3 years ago
Read 2 more answers
Other questions:
  • In humans, the ability to roll up the sides of the tongue into a U-shape is controlled by one gene. Ability to roll the tongue i
    5·1 answer
  • Eating a pop tart gives you _________.<br> a. chemical energyb. nuclear energyc. light energy
    11·1 answer
  • 21. Cells of the immune system are able to respond to the presence of
    11·1 answer
  • Wht is the orbital radius in kilometers
    6·1 answer
  • Explain how the respiratory system and the circulatory system work together to respond to your body's needs during vigorous exer
    10·1 answer
  • Hormone that stimulates the growth and secretions of the adrenal cortex
    7·1 answer
  • Which of the following is attached to the transfer RNA (TRNA)? *
    13·1 answer
  • I need help with csi wildelife bruh
    13·2 answers
  • Liz is examining a plant cell under a microscope. She sees many small green strutures inside the cell. Her teacher explains that
    14·2 answers
  • What is the difference between a missense mutation and a silent mutation?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!