1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mihalych1998 [28]
2 years ago
12

The model show's a portion of a DNA strand. What does the pentagon represent in the model?

Biology
1 answer:
Anika [276]2 years ago
3 0
The pentagon represents a nucleotide.
You might be interested in
What is the relationship between concentration gradients and the two kinds of transport?
Dmitriy789 [7]

Answer:

A concentration gradient occurs when the concentration of particles is higher in one area than another. In passive transport, particles will diffuse down a concentration gradient, from areas of higher concentration to areas of lower concentration, until they are evenly spaced.

well hope this help at least (good night)

6 0
3 years ago
What cellular processes happen during mitosis?
Sedbober [7]

Answer:

the eukaryotic cell undergoes many phases to result in two daughter cells.

prophase

prometaphase

metaphase

anaphase

telophase

6 0
2 years ago
Read 2 more answers
Which form of energy is in firewood?<br> light<br> sound<br> kinetic<br> potential
Mashutka [201]

Answer: Stored potential energy

Explanation:

7 0
3 years ago
Read 2 more answers
When a traffic light malfunctions you should treat the malfunctioning light as a:?
Gekata [30.6K]
I think when a traffic light malfunctions you should treat the malfunctioning light as stop sign. There are many reasons for why a stop light will stop working or malfunction. mostly this happens if the electricity goes out or one of the bulbs in the signal dies. Malfunctioning traffic signs may be dangerous and many drivers find them confusing.
8 0
3 years ago
Speculate why a change in body temperature occurs?
PtichkaEL [24]
Climate change and emotions sometimes
Also sickness
Hope this helps
8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which adaptation is used by polar bears to maintain internal homeostasis in cold temperatures?
    13·2 answers
  • What would happen to a vacant lot in your community if it were left alone for the next 25 years.
    7·2 answers
  • Image courtesy of NASA
    7·1 answer
  • What do all forms of transport have in common?
    12·1 answer
  • Please help me!!! i would really appreciate it
    7·1 answer
  • 2. Write the complementary code for the following DNA replication.<br> A A T C G G C A T T A C O
    14·1 answer
  • Describe the three methods for harvesting stem cells, for each method, explain the benefits of the method and the ethical concer
    12·1 answer
  • The organization of a organism from smallest to largest is Cell, tissue, organ, organ system, organism
    9·1 answer
  • Pls help again, brainlist!!!!!!!!!!!!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!