Answer:
Human diploid cells have 23 pairs of chromosomes. Because of independent assortment during meiosis I, there are 223, or 8.4 million possible gametes that may be created even if crossing over didn't occur.
<span>B) The snakehead fish will replace the other fish species.</span>
Answer:
Volcanic degassing of volatiles, including water vapour, occurred during the early stages of crustal formation and gave rise to the atmosphere. When the surface of Earth had cooled to below 100 °C (212 °F), the hot water vapour in the atmosphere would have condensed to form the early oceans.
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved